Table 2 Amplicons Used for Primer Extension by Polymerase with 3′ Exonuclease Activity Using Different Types of 3′ Modified Primers^a

Template or SNP ID no.	Primer sequences	Type of modification	Single-nucleotide match/mismatch	Products related to SNP assay
3′.tcttaa..	atcccaagatatctgagaatT	³[H]	A:T	Hot products
3′.tcttaT..	atcccaagatatctgagaatT	³[H]	T:T	Cold products
3′.cttaag..	atcccaagatatctgagaattC	Rox	G:C	Rox integrated
3′.cttaaC..	atcccaagatatctgagaattC	Rox	C:C	Rox removed/no product
3′.cttaag..	atcccaagatatctgagaattc	PTO	G:C	Primer extended
3′.cttaaC..	atcccaagatatctgagaattc	PTO	C:C	No products
GJB3:C& →; T^b
ACGGG	catcgtggactgctacattgccC	PTO	C:G	Primer extended
ACGGG	catcgtggactgctacattgccT	PTO	G:T	No product
Human cyclophilin A
3′gggaac	tactcacgccttccttcccttg	PTO	A:T	Primer extended
3′gggaac	tactcacgccttccttcccAtg	PTO	A:A	No products

PTO, phosphorothioate; SNP, single nucleotide polymorphism.
The SNP to be assayed was bolded.
^aThe antisense sequences are 5′-gaaacagctgaatggacccaa-3′ for the short artificial amplicon; antisense used for SNP 4343 was tctgtaagccactgctggag and for SNP M235T was agcccttcatcttcccttggaa.
^b^b Homozygous wild type.

Quick links

Search