Table 1 Mutations on the ATP2C1 gene reported in the literature

From: ATP2C1 gene mutations in Hailey–Hailey disease and possible roles of SPCA1 isoforms in membrane trafficking

Exon/Intron	Nucleotide change	Mutation	Number ^a	Codon ^b	Effect	Domain ^c	References
Exon 2	28delG/ins24bp^d	Deletion/insertion	1		PTC	N-ter	^{6, 23} ^d
Exon 2^d	115C>T	Nonsense	4	R39X	PTC	N-ter/s1	^{6, 18, 19}
Intron 2	117+2T>G	Donor splice	1		PTC(?)	N-ter/s1	⁹⁵
Intron 2	118-2A>G	Acceptor splice	1		PTC	N-ter/s1	⁹⁶
Intron 2	118-1G>A	Acceptor splice	3			N-ter/s1	²² ^e ^, ^{23, 97} ^d ^, ^f
Exon 3^d	134delG	Deletion	1	45GfsX1	PTC	N-ter/s1	⁹⁸
Exon 3	163C>T	Nonsense	3	R55X	PTC	N-ter/s1	^{31, 97} ^d ^, ^f ^, ⁹⁹
Exon 3	168delC	Deletion	1	?	PTC	N-ter/s1	³¹
Exon 3	180G>A^d	Nonsense	1	W60X	PTC	N-ter/s1	⁹⁷
Exon 3	185delAGTT	Deletion	1	62KfsX34	PTC	N-ter/s1	²⁸
Exon 3	212delT	Deletion	1	71LfsX26	PTC	M1	¹⁰⁰ ^g
Intron 3	235-2A>G	Acceptor splice	2			M1	^{101, 102}
Exon 5	335delT	Deletion	1	111LfsX19	PTC	M2	²³
Intron 5	360+1G>A	Donor splice	1			M2	³³
Intron 5	360+1G>C	Donor splice	1		Skip exon 5	M2	²⁴
Intron 5	360+2T>A	Donor splice	2		Skip exon 5	M2	¹⁰³
Intron 5	361–1G>A^d	Acceptor splice	1		PTC/skip exon 6	M2	¹⁹
Intron 5^d	361-2A>G^d	Acceptor splice	1		PTC/loss exon 6	M2	¹⁰⁴
Exon 6	366T>A	Nonsense	1	Y122X	PTC	M2	¹⁰⁵
Exon 7	457C>T	Nonsense	8	R153X	PTC	A	^{7, 20, 21, 23, 24, 25} ^e ^, ¹⁰⁶
Exon 7	490delT	Deletion	1	163LfsX24	PTC	A	¹³
Exon 7	519insA	Insertion	2	173LfsX3	PTC	A	^{13, 33}
Exon 7	520delC	Deletion	1	174RfsX14	PTC	A	²⁴
Intron 7	531+2T>A^d	Donor splice	1			A	¹⁸
Exon 8	602C>T^h	Missense	2	P201L^h		A	⁶ ^d ^, ¹³
Exon 8^d	635C>A	Nonsense	1	S212X	PTC	A	⁹⁶
Exon 8	661A>C^d	Missense	1	T221P		A	⁸⁷
Exon 8	681dupA	Insertion	1	227KfsX13	PTC	A	²⁴
Intron 8	688-1G>A	Acceptor splice	1			A	¹³
Exon 9	689G>A	Missense	1	G230D		A	¹⁰⁷
Exon 9	705delA	Deletion	1	235TfsX12	PTC	A	¹⁰⁸
Exon 9	745C>T	Nonsense	1	Q249X	PTC	S3	¹³
Exon 10	767insCCCT	Insertion	1	256TfsX42	PTC	S3	⁷
Exon 10	775C>T	Nonsense	1	Q259X	PTC	S3	¹⁰⁵
Exon 10	806T>G	Missense	1	L269R		M3	¹⁰⁵
Exon 10	832G>Aⁱ	Missense/insertion	2	278GfsX22		M3	⁹¹
Intron 10	832+3A>T	Donor splice	2			M3	¹³
Intron 10	832+2T>C	Donor splice	1		Skip exon 10	M3	²⁰
Intron 10^d	833-1G>A^d	Acceptor splice	1			M3	⁶
Exon 11	836insT	Insertion	1	279IfsX19	PTC	M3	⁷
Exon 11	854G>A	Nonsense	1	W285X	PTC	l2	⁹⁵
Intron 11	899+1G>T	Donor splice	1		PTC	M4	²⁴
Intron 11	899+1G>C	Donor splice	2		PTC	M4	¹⁰⁹
Exon 12	910G>T	Missense	2	A304S		M4	⁷ ^j ^, ²⁰
Exon 12	920C>T	Missense	1	P307L		M4	¹⁰⁴
Exon 12	920C>A	Missense	1	P307H		M4	³⁶
Exon 12	923delAAG	Deletion	1	308delE^k		M4	²⁸
Exon 12	925G>T	Missense	1	G309C		M4	¹³
Exon 12	932del21bp^d	Deletion	1	311del^d		M4	¹⁸
Exon 12	935T>C	Missense	1	I312T		M4	¹¹⁰
Exon 12	950del9bp/ins24bp^l	Deletion/insertion	1	318-320del/ins^l		S4	²⁰
Exon 12	953T>C	Missense	1	L318P		S4	⁷
Exon 12	956delC	Deletion	1	319AfsX3	PTC	S4	²⁴
Exon 12	1001delA	Deletion	1	333KfsX12	PTC	S4	¹³
Exon 12	1004T>C	Missense	1	L335P		S4	¹¹¹
Exon 12	1022T>C	Missense	1	L341P		S4	¹³
Intron 12	1024+1G>A^d	Donor splice	1		PTC/skip exon 12	S4	²¹
Exon 13	1031G>A^d^, ^h	Missense	1	C344Y^d^, ^h		P	⁶
Exon 13	1042T>C	Missense	1	C348R		P	¹⁰⁵
Exon 13	1045delT	Deletion	1	348CfsX6	PTC	P	¹³
Exon 13	1049A>T	Missense	3	D350V		P	²⁸
Exon 13	1055C>T^d	Missense	1	T352I		P	¹¹²
Exon 13	1058G>T^d	Missense	1	G353V		P	³⁰
Exon 13^d	1067delC	Deletion	1	356TfsX3	PTC	P	⁹⁶
Exon 13	1068del16bp^m	Deletion	1	356TfsX60	PTC	P	¹¹³
Exon 13	1085insA	Insertion	1	363TfsX11	PTC	P	²⁹
Exon 13	1087A>G	Missense	1	T363A		P	¹¹⁴
Exon 13	1089delTCAC	Deletion	4	363TfsX21	PTC	P	^{13, 23, 28, 115}
Exon 14	1218G>C^d	Missense	1	E406D	Skip exon 14	P	¹⁹
Exon 15	1231T>C	Missense	1	C411R		P	¹³
Exon 15^d	1250G>A^d	Missense	3	R417K		P	³²
Intron 15	1308+1G>A	Donor splice	1			P	³⁶
Intron 15	1309-1G>A	Acceptor splice	1			P	¹³
Intron 15	1309-4a>t/1309-2a>g	Acceptor splice	1		Skip exon 16	P	⁷
Exon 16	1327C>T^d	Nonsense	1	Q443X^d	PTC	P	⁶
Exon 16	1388T>G	Missense	1	V463G		P	²⁰
Exon 16	1402C>T	Nonsense	4	R468X	PTC	P	^{7, 26, 27, 28}
Exon 16	1413G>C	Missense	1	Q471H		?	¹¹⁰
Intron 16	1415-2A>C	Acceptor splice	1		PTC/skip exon 17	?	¹⁰⁴
Exon 17	1413del28bpⁿ	Deletion	2	472DfsX14	PTC	?	¹¹⁶
Exon 17	1431T>A	Nonsense	1	C477X	PTC	?	¹¹⁷
Exon 17	1455delA^d	Deletion	1	485QfsX1	PTC	N?	¹¹⁸
Exon 17	1462del^d^,^o	Deletion	1	488del^o		N	¹⁰⁴
Exon 17	1469G>T	Missense	1	C490F		N	³¹
Exon 17	1508delCTCA^d	Deletion	1	503TfsX32	PTC	N	¹⁸
Exon 17	1510C>T	Nonsense	1	Q504X	PTC	N	³⁶
Exon 17	1516C>T	Nonsense	4	Q506X	PTC	N	^{29, 30} ^d
Exon 17	1523delAT	Deletion	2	508DfsX23	PTC	N	^{97, 104}
Exon 17	1566delCA	Deletion	1	522LfsX9	PTC	N	⁷
Intron 17	1570+2T>C	Donor splice	1		PTC	N	²⁴
Exon 18	1582G>C	Missense	1	A528P		N	²³
Exon 18	1588G>C	Missense	1	G530R		N	⁹⁵
Exon 18	1685C>G	Nonsense	3	S562X	PTC	N	⁶ ^d ^, ^{13, 28}
Exon 18	1709C>T^d^, ^h	Missense	2	T570I^d^, ^h		N	⁶
Exon 18	1723delG	Deletion	1	574QfsX24	PTC	N	¹³
Exon 18	1738A>G	Missense	2	I580V		N	^{13, 31}
Intron 18	1694-1G>A	Acceptor splice	1			N	⁶
Exon 19	1751T>C	Missense	1	L584P		N	²¹
Exon 19	1782delAGTC	Deletion	1	593SfsX5	PTC	N	¹¹⁹
Exon 19	1816C>T	Nonsense	1	Q606X	PTC	N	¹³
Intron 19	1839+2insT^d	Donor splice	1		PTC	N	²³
Intorn 19	1840-1G>C	Acceptor splice	1			N	⁹⁸
Exon 20	1854G>A^d	Missense	1	R619K		N	⁸⁷
Exon 20	1869delG	Deletion	1	623RfsX2	PTC	N	³³
Exon 20	1874delA	Deletion	1	M626X	PTC	N	¹²⁰
Exon 20	1875delG	Deletion	1	M626X	PTC	s5	⁷
Intron 20	1890+1delGTGAG/ins	Donor splice	1			s5	²² ^e
Intron 20	1891-1G>T	Acceptor splice	1			s5	¹²¹
Exon 21	1897C>T	Nonsense	1	Q633X	PTC	s5	¹²²
Exon 21	1914del/ins^d	Deletion/insertion	1	638Vfs10X	PTC	s5	¹²³ ^d
Exon 21	1922T>G	Missense	1	M641R		s5	⁷
Exon 21^d	1931A>G	Missense	1	D644G		s5	³³
Exon 21	1933G>A	Missense	1	G645R		s5	⁷
Exon 21	1934G>T^d	Missense	1	G645V		s5	¹²⁴
Exon 21	1942G>T	Missense	1	D648Y		s5	¹⁰⁴
Exon 21	1952C>A	Missense	1	A651D		s5	¹⁰⁵
Exon 21	1982T>G	Missense	1	M661R		s5	¹¹³
Exon 21	1983delG	Deletion	1	661MfsX14	PTC	s5	⁷
Exon 21	2023delA^d	Deletion	1	675MfsX	PTC	s5	¹⁸
Exon 21	2025delG	Deletion	1	675MfsX2	PTC	s5	¹⁰⁵
Intron 21^d	2058(-17C>T)^d	Acceptor splice	1		PTC	s5	⁹⁷
Intron 21^d	2058-1G>C^d	Acceptor splice	1			s5	²⁸
Intron 21	2058-1G>A	Acceptor splice	1		Skip exon 22	s5	⁷
Exon 22	2068G>T	Nonsense	1	E690X	PTC	s5	¹¹⁰
Exon 22	2111insA	Insertion	1	704RfsX23	PTC	M5	²⁰
Exon 22	2126C>T	Missense	3	T709M		M5	^{7, 28, 107}
Intron 22	2127+1G>A^d	Donor splice	2		Skip exon 23 (?)	M5	²⁸ ^d ^, ¹²⁵ ^d
Intron 22^d	2126(+5G>A)^d	Donor splice	1		PTC	M5	⁹⁷
Exon 23	2132T>G	Missense	1	I711R		M5	³¹
Exon 23	2141T>A	Nonsense	1	L714X	PTC	M5	²³
Exon 23	2164insACAT	Insertion	1	722LfsX6	PTC	l3	¹²²
Exon 23	2198A>G	Missense	1	Q733R		M6	³¹
Exon 23	2215delATT	Deletion	1	739delI		M6	²⁰
Exon 23	2224G>T	Missense	1	D742Y		M6	¹³
Exon 23	2227delG^d	Deletion	1	743GfsX8	PTC	M6	⁶
Exon 23	2231C>G	Missense	2	P744R		M6	⁷ ^p ^, ²⁰
Exon 23	2235insC	Insertion	1	746AfsX10	PTC	M6	¹⁰⁷
Exon 23	2236G>A^d	Missense	1	A746T^d		M6	¹⁸
Exon 23	2237C>T^d	Missense	1	A746V		M6	³⁴
Intron 23	2243+2T>C	Donor splice	1		PTC	M6	¹⁰⁴
Exon 24	2246T>G	Missense	1	L749R		M6	²⁰
Exon 24	2251delGT	Deletion	1	751VfsX5	PTC	s6	¹²⁶
Exon 24	2264delA	Deletion	2	755DfsX17	PTC	s6	^{25, 33}
Exon 24	2303delAC	Deletion	2	768DfsX4	PTC	s6	^{7, 20}
Exon 24	2339delTTGT^d	Deletion	1	780LfsX3	PTC	M7	¹⁹
Exon 24	2357delTT	Deletion	1	786IfsX10	PTC	M7	⁷
Exon 24	2365G>A	Missense	1	G789R		M7	¹³
Exon 24	2371delTTGT	Deletion	4	791LfsX12	PTC	M7	^{7, 20, 127} ^d
Exon 24	2374delTTTG	Deletion	10	792FfsX10	PTC	M7	⁶ ^d ^, ^{7, 13, 23, 31, 117, 128, 129} ^d ^, ¹³⁰
Exon 24	2375delTTGT	Deletion	2	792FfsX4	PTC	M7	^{102, 104}
Exon 24	2384G>A	Nonsense	1	W795X	PTC	l4	²² ^e
Exon 25	2395C>T	Nonsense	14	R799X	PTC	l4	¹⁶ ^d ^, ^{25, 31, 32, 33, 34} ^d
Exon 25^d	2412delT	Deletion	1	803IfsX7	PTC	l4	¹⁰²
Exon 25	2416C>T	Nonsense	1	R806X	PTC	l4	¹³
Exon 25	2422delAC	Deletion	2	808TfsX10	PTC	l4	³³
Exon 25	2445del10bp	Deletion	3	814CfsX7	PTC	M8	¹³¹
Exon 25	2454delT	Deletion	1	818FfsX6	PTC	M8	³¹
Exon 25	2454dupT	Insertion	1	D819X	PTC	M8	²⁸
Exon 25	2460delG	Deletion	1	820MfsX4	PTC	M8	²¹
Exon 25	2468A>C^d	Missense	2	A823E		M8	⁹⁷
Exon 26	2529delGT	Deletion	1	843MfsX27	PTC	M9	⁷
Exon 26	2558del10bp^q	Deletion	1	853MfsX17	PTC	M9	³¹
Exon 26	2593C>T^d	Nonsense	2	Q865X^d	PTC	l5	^{6, 112}
Exon 26^d	2597A>C	Missense	1	K866T		l5	⁹⁶
Intron 26	2630-1delG	Acceptor splice	2			M10	⁶ ^d ^, ¹³
Exon 27	2660C>A	Nonsense	1	S887X	PTC	M10	²² ^e

Appendix 1
Exon 23	2130T>C^d	Polymorphism	1	S710S^d		M5	^{87, 88}

Appendix 2
Number	Mutation	%	PTC	%
59	Deletion/insertion	35.54	55	59.78
24	Nonsense	14.46	24	26.09
49	Missense	29.52	0	0.00
34	Acceptor/donor splice	20.48	13	14.13
166			92	55.42

Appendix 3
Normal
p.309	G	G	P	I	V	V	T	V	T	L	A	L	p.320
c.925	GGT	CTC	CCC	ATT	GTG	GTC	ACA	GTG	ACG	CTA	GCT	CTT	c.960
c.925	GGT	CTC	CTA	GCT	CTT	c.939
p.309	G	L	L	A	L	p.313
Mutant

Human ATP2C1 gene mutations were summarized. The mutations are grouped for deletion/insertion (azure), nonsense (orange), missense (yellow), acceptor/donor splice (green). Nucleotides are reported in italic along the table as well as in the figure legend and along the full manuscript. We found some reported mutations were inaccurate or not unified. Therefore, we revised or collated some descriptions according to the reported cDNA reference sequence (GenBank accession No. NM_AF181120).⁷
Appendix 1: A polymorphism was wrongly reported to be a new mutation 2323C>T generating Y711H.⁸⁷ After careful check with the correct reading frame this was not a mutation but a polymorphism.⁸⁸
Appendix 2: A resuming panel graphs the amount and relative percentage of each kind of mutations and PTC.
Appendix 3: The 884–904delCCATTGTGGTCACAGTGACGC mutation and consequent amino acid 296-302delIVVTVTL was incorrectly reported,¹⁸ while it referred to as a 21bp deletion located at 932-952 and amino acid 311-317delPIVVTVT. This mutation did not generate the reported missense mutation P295V;¹⁸ the first ‘C’ of the codon 311 (encoding for a proline, P) recombined with ‘TA’ of codon 318 (leucine, L) generating the codon CTA which encoded for a leucine.
^aNumber of reported cases of patients presenting the mutation.
^bMissense mutations causing an amino acid substitution in extremely conserved residue through all the ATPases and in different species are highlighted in light pink.²³
^cPutative protein domain prediction is based on the position of the equivalent residue within the structure of ATP2A1 (SERCA1).
^dUsing the running correct coding sequence and relative reading frame of the ATP2C1 gene (Ref. NG_007379.1) we unified the position of the mutation site, protein change, exon/intron location all over the reported mutations. In doing this we found few mutations published as new which were already known.
^eThe same authors published their findings in two identical papers on different journals.^{22, 89}
^fDue to incorrect interpretation of discovered mutations the authors reported as new previously reported mutations.⁹⁰
^gIn their manuscript, the authors reported a previously described mutation. A mistake on referring to this mutation was recently reported (see erratum in Acta Derm Venereol 2015; 95: 1040).
^hP201L, C344Y, and T570I, respectively, represent mutations P185L, C328Y, and T554I, originally reported by Sudbrak et al.⁶ Mutation nomenclature has now been updated with respect to the 5'-end sequence published by Hu et al⁷ and the results of 5' RACE-PCR experiments from Fairclough et al.³⁶
ⁱThe missense mutation 832G>A causing the nucleotide change G278R generated an aberrant splicing with a resulting insertion of the first 11 bp (GTAAGAGAAGA) from intron 10 between the mutated exon10 and the exon 11 (see Figure 5 in Chao et al)⁹¹ causing a PTC.
^jThis mutation was incorrectly reported as A304T by Hu et al⁷ as previously reported.²⁰
^kE308, and not G309 (which are both Ca2+-binding site residue), was deleted.
^l950delC GCTAGCTCT T>CT>insC CACAATGTGTTGGTGTTATGAGAA T (underlined are the deleted/inserted nucleotides) generates the in frame 318delLAL/insTMCWCYEN.
^m1068delAAGAATGAAATGACTG.
ⁿThe delGACAGACCAGAGATTTGTTTTATGAAAG cause a frame shift and PTC.
^oIn frame delAAGTACTGTACTACATACCAGAGC with amino acid delKYCTTYQS.
^pThis mutation was incorrectly reported as P724R by Hu et al⁷ as previously reported.²⁰
^qThe deleted sequence is TGGGACAATT.

Back to article page

Table 1 Mutations on the ATP2C1 gene reported in the literature

Search

Quick links