Correction to: Leukemia (2014) 28, 182–185; doi: 10.1038/leu.2013.282; published online 18 October 2013
There is an incorrect sequence for the primer ‘reverse 2’ in Supplementary Information (Methods, page 2, row 44). The original sequence ‘CATCTCAGATGTCTTGCTAGGGGACTC’ needs to be corrected as follows: ‘TGTAGATTCTCTTGCAGGGATGTACACTG’.
The authors would like to apologise for any inconvenience.
Additional information
The online version of the original article can be found at 10.1038/leu.2013.282
Rights and permissions
About this article
Cite this article
Zaliova, M., Zimmermannova, O., Dörge, P. et al. Erratum: ERG deletion is associated with CD2 and attenuates the negative impact of IKZF1 deletion in childhood acute lymphoblastic leukemia. Leukemia 29, 1222 (2015). https://doi.org/10.1038/leu.2015.77
Published:
Issue date:
DOI: https://doi.org/10.1038/leu.2015.77
