Extended Data Figure 2: Arl13b–mCherry–GECO1.2 transgenic mouse.

a, Transgene orientation and integration site. The transgene was integrated into the non-coding region of chromosome 1 (position 174,611,500). b, The genotype of transgenic animals was determined by PCR using the following primers: 372-up, ACATGGCCTTTCCTGCTCTC; 372-down, TTCAACATTTCCGTGTCGCC; and 944-down, GACATCTGTGGGAGGAGTGG. The PCR product for wild-type genomic sequence was ~600 bp; the transgene PCR product was ~400 bp. c, mIMCD cells isolated from Arl13b–mCherry–GECO1.2^tg mice were imaged after permeabilization with 15 μM digitonin in varying extracellular [Ca²⁺]. Average ratios (n = 12 cilia per each data point) are plotted versus free [Ca²⁺]. Arl13b–mCherry–GECO1.2 calibration fitted by a Boltzmann curve (R² = 0.98; K_d = 442 nM). d, Phenotype of Arl13b–mCherry–GECO1.2^tg/tg mice. Mouse organ morphology/orientation appeared normal (heterotaxy was not observed) and breeding animals had normal litter sizes (6–8 for C57Bl/6 (ref. 41)). All error bars ± s.e.m.