Table 2 Probes used for FISH.
From: Size-independent symmetric division in extraordinarily long cells
Probe | Specificity | Sequence/5′ modification | Target RNA | Position* | Formamide percentage/incubation time (h)/probe concentration (ng μl−1) | Reference |
|---|---|---|---|---|---|---|
EUB338 | Most bacteria | 5′- GCTGCCTCCCGTAGGAGT -3′ Fluorescein | 16S | 338–355 | 40%/12/3.8 | Amann et al.56 |
GAM42a | Gammaproteobacteria | 5′- GCCTTCCCACATCGTTT -3′ Cy5 | 23S | 1,027–1,043 | 40%/12/2.4 | Manz et al.55 |
BETA42a | Betaproteobacteria | 5′- GCCTTCCCACTTCGTTT -3′ Cy3 | 23S | 1,027–1,043 | 40%/12/2.4 | Manz et al.55 |
Eds214 | E. dianeae ectosymbiont | 5′- GCTCATCATCATAGCGGAA -3′ Cy3 | 16S | 214–235 | 40%/12/2.4 | This study |
Eds214mis | One mismatch to the E. dianeae ectosymbiont | 5′- GGCTCATCATCTTAGCGGAAG -3′ Cy3 | 16S | 214–235 | 40%/12/2.4 | This study |
SRB64 | Sulphate-reducing Deltaproteobacteria identified in the 16S rRNA gene library | 5′- TGCAAGCAACCCCTTTCTCGTT -3′ Fluorescein | 16S | 64–86 | 40%/12/3.8 | This study |
Efs1027 | E. fertilis ectosymbiont | 5′- TCACCGCGCTCCCAAGG -3′ Cy3 | 16S | 1,027–1,044 | 30%12/2.4 | This study |
Efs1027mis | One mismatch to the E. fertilis ectosymbiont | 5′- TCACCGCGCACCCAAGG -3′ Cy3 | 16S | 1,027–1,044 | 30%12/2.4 | This study |
