Supplementary Figure 6: shTcf7 constructs reduce Tcf7 transcript levels in ETP and DN2 cells.
From: Asynchronous combinatorial action of four regulatory factors activates Bcl11b for T cell commitment
Quantitative real time (RT)-PCR analysis of Tcf7 transcript levels in DN progenitors from E14.5 fetal livers infected with the indicated shRNA constructs for 2 days and sorted. RNA was extracted and processed as previously described7. Forward and reverse primers used for Tcf7 detection are CAAGGCAGAGAAGGAGGCTAAG and GGCAGCGCTCTCCTTGAG respectively, as previously described8.
