Abstract
The genetic basis for the development of brainstem neurons that generate respiratory rhythm is unknown. Here we show that mice deficient for the transcription factor MafB die from central apnea at birth and are defective for respiratory rhythmogenesis in vitro. MafB is expressed in a subpopulation of neurons in the preBötzinger complex (preBötC), a putative principal site of rhythmogenesis. Brainstems from Mafb−/− mice are insensitive to preBötC electrolytic lesion or stimulation and modulation of rhythmogenesis by hypoxia or peptidergic input. Furthermore, in Mafb−/− mice the preBötC, but not major neuromodulatory groups, presents severe anatomical defects with loss of cellularity. Our results show an essential role of MafB in central respiratory control, possibly involving the specification of rhythmogenic preBötC neurons.
This is a preview of subscription content, access via your institution
Access options
Subscribe to this journal
Receive 12 print issues and online access
$259.00 per year
only $21.58 per issue
Buy this article
- Purchase on SpringerLink
- Instant access to full article PDF
Prices may be subject to local taxes which are calculated during checkout








Similar content being viewed by others
References
Monteau, R. & Hilaire, G. Spinal respiratory motoneurons. Prog. Neurobiol. 37, 83–144 (1991).
Bianchi, A.L., Denavit-Saubie, M. & Champagnat, J. Central control of breathing in mammals: neuronal circuitry, membrane properties, and neurotransmitters. Physiol. Rev. 75, 1–45 (1995).
St-John, W.M. Neurogenesis of patterns of automatic ventilatory activity. Prog. Neurobiol. 56, 97–117 (1998).
Rekling, J.C. & Feldman, J.L. PreBötzinger complex and pacemaker neurons: hypothesized site and kernel for respiratory rhythm generation. Annu. Rev. Physiol. 60, 385–405 (1998).
Hilaire, G. & Duron, B. Maturation of the mammalian respiratory system. Physiol. Rev. 79, 325–360 (1999).
Richter, D.W. & Spyer, K.M. Studying rhythmogenesis of breathing: comparison of in vivo and in vitro models. Trends Neurosci. 24, 464–472 (2001).
McCrimmon, D.R., Ramirez, J.M., Alford, S. & Zuperku, E.J. Unraveling the mechanism for respiratory rhythm generation. Bioessays 22, 6–9 (2000).
Feldman, J.L., Mitchell, G.S. & Nattie, E.E. Breathing: rhythmicity, plasticity, chemosensitivity. Annu. Rev. Neurosci. (e-pub, 2003).
Onimaru, H. & Homma, I. A novel functional neuron group for respiratory rhythm generation in the ventral medulla. J. Neurosci. 23, 1478–1486 (2003).
Mellen, N.M., Janczewski, W.A., Bocchiaro, C.M. & Feldman, J.L. Opioid-induced quantal slowing reveals dual networks for respiratory rhythm generation. Neuron 37, 821–826 (2003).
Onimaru, H., Arata, A. & Homma, I. Intrinsic burst generation of preinspiratory neurons in the medulla of brainstem-spinal cord preparations isolated from newborn rats. Exp. Brain Res. 106, 57–68 (1995).
Smith, J.C., Ellenberger, H.H., Ballanyi, K., Richter, D.W. & Feldman, J.L. Pre-Botzinger complex: a brainstem region that may generate respiratory rhythm in mammals. Science 254, 726–729 (1991).
Di Pasquale, E., Monteau, R. & Hilaire, G. In vitro study of central respiratory-like activity of the fetal rat. Exp. Brain Res. 89, 459–464 (1992).
Koshiya, N. & Guyenet, P.G. Tonic sympathetic chemoreflex after blockade of respiratory rhythmogenesis in the rat. J. Physiol. 491, 859–869 (1996).
Ramirez, J.M., Schwarzacher, S.W., Pierrefiche, O., Olivera, B.M. & Richter, D.W. Selective lesioning of the cat pre-Botzinger complex in vivo eliminates breathing but not gasping. J. Physiol. 507, 895–907 (1998).
Solomon, I.C., Edelman, N.H. & Neubauer, J.A. Patterns of phrenic motor output evoked by chemical stimulation of neurons located in the pre-Botzinger complex in vivo. J. Neurophysiol. 81, 1150–1161 (1999).
Gray, P.A., Janczewski, W.A., Mellen, N., McCrimmon, D.R. & Feldman, J.L. Normal breathing requires preBotzinger complex neurokinin-1 receptor–expressing neurons. Nat. Neurosci. 4, 927–930 (2001).
Jacquin, T.D. et al. Reorganization of pontine rhythmogenic neuronal networks in Krox-20 knockout mice. Neuron 17, 747–58 (1996).
Poon, C.S., Zhou, Z. & Champagnat, J. NMDA receptor activity in utero averts respiratory depression and anomalous long-term depression in newborn mice. J. Neurosci. 20, RC73 (2000).
Shirasawa, S. et al. Rnx deficiency results in congenital central hypoventilation. Nat. Genet. 24, 287–290 (2000).
Fortin, G. et al. Genetic and developmental models for the neural control of breathing in vertebrates. Respir. Physiol. 122, 247–257 (2000).
Del Toro, E.D. et al. Generation of a novel functional neuronal circuit in Hoxa1 mutant mice. J. Neurosci. 21, 5637–5642 (2001).
Qian, Y. et al. Formation of brainstem (nor)adrenergic centers and first-order relay visceral sensory neurons is dependent on homeodomain protein Rnx/Tlx3. Genes Dev. 15, 2533–2545 (2001).
Sieweke, M.H., Tekotte, H., Frampton, J. & Graf, T. MafB is an interaction partner and repressor of Ets-1 that inhibits erythroid differentiation. Cell 85, 49–60 (1996).
Kelly, L.M., Englmeier, U., Lafon, I., Sieweke, M.H. & Graf, T. MafB is an inducer of monocytic differentiation. Embo J. 19, 1987–1997 (2000).
Sadl, V.S. et al. The mouse kreisler segmentation gene is required for differentiation of glomerular visceral epithelial cells. Dev. Biol. 249, 16–29 (2002).
Cordes, S.P. & Barsh, G.S. The mouse segmentation gene kr encodes a novel basic domain-leucine zipper transcription factor. Cell 79, 1025–1034 (1994).
Hertwig, P. Neue Mutationen und Kopplungsgruppen bei der Hausmaus. Z.indukt. Abst. Vererb. Lehre 80, 220–246 (1942).
Eichmann, A. et al. The expression pattern of the Mafb/kr gene in birds and mice reveals that the kreisler phenotype does not represent a null mutant. Mech. Dev. 65, 111–122 (1997).
Chatonnet, F., del Toro, E.D., Voiculescu, O., Charnay, P. & Champagnat, J. Different respiratory control systems are affected in homozygous and heterozygous kreisler mutant mice. Eur. J. Neurosci. 15, 684–692 (2002).
Hilaire, G., Bou, C. & Monteau, R. Rostral ventrolateral medulla and respiratory rhythmogenesis in mice. Neurosci. Lett. 224, 13–16 (1997).
Errchidi, S., Hilaire, G. & Monteau, R. Permanent release of noradrenaline modulates respiratory frequency in the newborn rat: an in vitro study. J. Physiol. 429, 497–510 (1990).
Wang, W., Fung, M.L. & St John, W.M. Pontile regulation of ventilatory activity in the adult rat. J. Appl. Physiol. 74, 2801–2811 (1993).
Viemari, J.C., Burnet, H., Bevengut, M. & Hilaire, G. Perinatal maturation of the mouse respiratory rhythm-generator: in vivo and in vitro studies. Eur. J. Neurosci. 17, 1233–1244 (2003).
Koshiya, N. & Smith, J.C. Neuronal pacemaker for breathing visualized in vitro. Nature 400, 360–363 (1999).
Lieske, S.P., Thoby-Brisson, M., Telgkamp, P. & Ramirez, J.M. Reconfiguration of the neural network controlling multiple breathing patterns: eupnea, sighs and gasps. Nat. Neurosci. 3, 600–607 (2000).
Gray, P.A., Rekling, J.C., Bocchiaro, C.M. & Feldman, J.L. Modulation of respiratory frequency by peptidergic input to rhythmogenic neurons in the preBotzinger complex. Science 286, 1566–1568 (1999).
Pabst, O., Rummelies, J., Winter, B. & Arnold, H.H. Targeted disruption of the homeobox gene Nkx2.9 reveals a role in development of the spinal accessory nerve. Development 130, 1193–1202 (2003).
Wang, H., Stornetta, R.L., Rosin, D.L. & Guyenet, P.G. Neurokinin-1 receptor-immunoreactive neurons of the ventral respiratory group in the rat. J. Comp. Neurol. 434, 128–146 (2001).
Guyenet, P.G., Sevigny, C.P., Weston, M.C. & Stornetta, R.L. Neurokinin-1 receptor-expressing cells of the ventral respiratory group are functionally heterogeneous and predominantly glutamatergic. J. Neurosci. 22, 3806–3816 (2002).
Ptak, K. et al. The murine neurokinin NK1 receptor gene contributes to the adult hypoxic facilitation of ventilation. Eur. J. Neurosci. 12, 2245–2252 (2002).
Thoby-Brisson, M. & Ramirez, J.M. Role of inspiratory pacemaker neurons in mediating the hypoxic response of the respiratory network in vitro. J. Neurosci. 20, 5858–5866 (2000).
Guyenet, P.G. & Wang, H. Pre-Botzinger neurons with preinspiratory discharges “in vivo” express NK1 receptors in the rat. J. Neurophysiol. 86, 438–446 (2001).
Champagnat, J. & Fortin, G. Primordial respiratory-like rhythm generation in the vertebrate embryo. Trends Neurosci. 20, 119–124 (1997).
Ren, J. et al. Absence of Ndn, encoding the Prader-Willi syndrome-deleted gene necdin, results in congenital deficiency of central respiratory drive in neonatal mice. J. Neurosci. 23, 1569–1573 (2003).
Amiel, J. et al. Polyalanine expansion and frameshift mutations of the paired-like homeobox gene PHOX2B in congenital central hypoventilation syndrome. Nat. Genet. 33, 459–461 (2003).
Filiano, J.J. & Kinney, H.C. A perspective on neuropathologic findings in victims of the sudden infant death syndrome: the triple-risk model. Biol. Neonate 65, 194–197 (1994).
Kinney, H.C. et al. Decreased muscarinic receptor binding in the arcuate nucleus in sudden infant death syndrome. Science 269, 1446–1450 (1995).
Kinney, H.C., Filiano, J.J. & White, W.F. Medullary serotonergic network deficiency in the sudden infant death syndrome: review of a 15-year study of a single dataset. J. Neuropathol. Exp. Neurol. 60, 228–247 (2001).
Tiveron, M.C., Hirsch, M.R. & Brunet, J.F. The expression pattern of the transcription factor Phox2 delineates synaptic pathways of the autonomic nervous system. J. Neurosci. 16, 7649–7660 (1996).
Acknowledgements
We thank F. Casagrande and the Klein lab at the European Molecular Biology Laboratory (EMBL, Heidelberg) for technical advice and V. Arce for pilot experiments and discussions. Blastocyst injections were carried out by F. Single (ZMBH, Heidelberg) and K. Vinterstein (EMBL, Heidelberg). L.M.K. was supported by the EMBL and the Association pour la Recherche sur le Cancer (ARC); B.B. was supported by the Association pour la Recherche sur la Polyarthrite (ARP). The project was supported by grants to M.S. from the ARC, La Ligue Nationale contre le Cancer (LNCC) and the Fondation pour la Recherche Medical (FRM).
Author information
Authors and Affiliations
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Supplementary information
Supplementary Fig. 1.
Anatomy and histology of peripheral respiratory apparatus in mafB-/- mice. (a-f) Hematoxylin/Eosin/Saffran stained sections of lung tissue (a,b), a cross section of the trachea with adjacent esophagus, blood vessels and vertebra (c,d) and intercostal musculature with adjacent rib (e,f) from mafB+/+ (a,c,e) and mafB-/- (b,d,f) E18.5 embryos. (g-h) Alizarin red / Alcian blue coloration of rib cage skeleton from mafB+/+ (g) and mafB-/- (h) E18.5 embryos showing bone in red and cartilage in blue. (i-j) Wholemount anti-Neurofilament immunohistochemistry on diaphragm from mafB+/+ (i) and mafB-/- (j) E14.5 embryos in an abdominal view. Scale bars represent 100 μm. Method: For histological analysis E18.5 embryos were fixed for 24h in formol, dehydrated and paraffin embedded. 8 μm sections were stained with Hematoxylin / Eosin / Saffran. Bone and cartilage staining was performed with Alizarin red for bones and Alcian blue for cartilage. For wholemount immunohistochemistry embryos were collected in PBS, fixed in methanol:DMSO (4:1) overnight at 4°C, and bleached in methanol:DMSO:30% H2O2 (4:1:1) for 4-5 hr at room temperature. Stainings were performed essentially as described with rabbit anti-neurofilament antibody (1:400) recognizing a 165-kD neurofilament protein and secondary peroxidase-conjugated goat anti-rabbit antibody. (JPG 82 kb)
Supplementary Fig. 2.
No increase in hypoxic marker VEGF in mafB-/- brainstems. RT-PCR analysis of VEGF hypoxia marker in brains from mafB+/- and mafB-/- E18.5 embryos. NIH-3T3 cells in absence or presence of the hypoxia mimetic compound CoCl2 (upper panel) and newborn wild type mice (P0) kept in air or in 7% O2 for 6 hours (lower panel) are shown as positive controls of VEGF induction under hypoxic conditions. Results are representative of two separate experiments. Method: Total RNA was isolated from brain preparations of E18.5 embryos or P0 newborns using RNeasy®mini kit (Quiagen). cDNA was synthesized using random hexamers and Superscript II (Invitrogen) following the manufacturer's recommendations. PCR was performed using specific primers for actin (5':CCTAAGGCCAACCGTGAAAAG, 3':CTTCATGGTGCTAGGAGCCA), and VEGF (5':GCGGGCTGCCTCGCAGTC, 3':TCACCGCCTTGGCTTGTCAC). PCR was performed on 2 μl, 0.5 μl and 0.125 μl of reverse transcription reaction for 16 to 20 cycles for actin and 24 to 28 cycles for VEGF. Representative results of several experiments are shown. Acquisition and quantification was performed using Diana and Aida software (Raytest). (JPG 8 kb)
Supplementary Fig. 3.
Neuronal expression of MafB in preBötC. (a-f) Double immuno-fluorescence for MafB and neuronal markers on preBötC cells. 20 μm sagittal frozen sections were stained with polyclonal anti-MafB antibody and either anti-β-III tubulin or anti-NeuN antibodies. Images were acquired by confocal microscopy to reveal MafB (a,b), β-III tubulin or NeuN (c,d) staining, and an overlap of both images (e,f). The scale bar represents 10 μm. Method: After post-fixation, tissue sections were incubated for 30 minutes with PBS/0.05% Tween20/1% BSA (PBST-BSA). Sections were incubated overnight at 4°C with anti-MafB rabbit antiserum (1/100), with anti-NeuN antibody (MAB377, Chemicon, 1/2000) or with anti-β-III tubulin antibody (MMS-435P, BabCo Covance research, 1/1000) in PBST-BSA. MafB, NeuN and β-III tubulin stainings were revealed with anti-rabbit AlexaFluor 488 (1/500) or anti-mouse AlexaFluor 594 (1/500) (Molecular Probes) respectively. (JPG 34 kb)
Supplementary Video 1.
3-D animation of mafB+/+ and mafB-/- preBötC as shown in Fig. 6e,f of the manuscript. (MOV 2002 kb)
Rights and permissions
About this article
Cite this article
Blanchi, B., Kelly, L., Viemari, JC. et al. MafB deficiency causes defective respiratory rhythmogenesis and fatal central apnea at birth. Nat Neurosci 6, 1091–1100 (2003). https://doi.org/10.1038/nn1129
Received:
Accepted:
Published:
Issue date:
DOI: https://doi.org/10.1038/nn1129
This article is cited by
-
Lymphatic MAFB regulates vascular patterning during developmental and pathological lymphangiogenesis
Angiogenesis (2020)
-
Loss of MafA and MafB expression promotes islet inflammation
Scientific Reports (2019)
-
Transcriptional regulation of endothelial cell behavior during sprouting angiogenesis
Nature Communications (2017)
-
Transcriptome of neonatal preBötzinger complex neurones in Dbx1 reporter mice
Scientific Reports (2017)
-
Pancreatic regeneration: basic research and gene regulation
Surgery Today (2016)