Table 2 Molecular characteristics of cutaneous and visceral SMARCA4-deficient undifferentiated malignant neoplasms.

From: Primary cutaneous SMARCA4-deficient undifferentiated malignant neoplasm: first two cases with clinicopathologic and molecular comparison to eight visceral counterparts

Site

SMARCA4 alterations

UV mutation signature

Other alterations of interest

Cutaneous Case 1

SMARCA4 c.4531 A > T (p.K1511*)a

SMARCA4 c.535 C > T (p.Q179*) a

Present

9p21.3 two copy deletion of CDKN2A

TP53 c.772 G > A (p.E258K)

TP53 c.833 C > T (p.P278L)

Cutaneous Case 2

SMARCA4 c.1492 C > T (p.Q498*)b

SMARCA4 c.1943_1943 + 1delinsAA ()b

Present

Single copy deletion of CDKN2A at 9p21.3

CDKN2A c.341_342delinsTT (p.P114L), exon 2

TP53 c.783-1 G > A ()

TP53 c.796_797delinsAA (p.G266K)

TP53 c.836_837delinsAA (p.G279E)

Single copy deletion of TP53 at 17p13.1

SMARCB1 single copy deletion at 22q11.23

Lung (n = 4)

Case 1

SMARCA4 c.3169-2 A > Tc

Absent

TP53 c.455_456insT (p.P153Afs*28)

Case 2

SMARCA4 c.942_943insC (p.A317Cfs*70)c

Chromosome 19p arm level loss (including SMARCA4)c

Absent

9p21.3 two copy deletion of CDKN2A

KRAS c.34 G > T (p.G12C)

KEAP1 c.880 G > C (P.D294H)

STK11 c.597 + 2 T > A ()

Case 3

SMARCA4 19p13.2 two copy deletion (exons 2-7)c

Absent

Chromosome 9 two copy loss of CDKN2A

TP53 c.725 G > C (p.C242S)

Chromosome 17p arm level loss (including TP53)

Chromosome 22q arm level loss (including SMARCB1)

Case 4

SMARCA4 19p13.2 two copy deletion (exons 4-11)c

Absent

Chromosome 9p loss of CDKN2A

CDKN2A c.251 A > G (p.D84G)

Esophagus (n = 2)

Case 1

SMARCA4 c.3013 C > T (p.R1005*)d

SMARCA4 exon 7 (chr19:11098548):: SMARCA4

exon 7 (chr19:11098573)

Absent

9p21.3-p24.3 single copy deletion of CDKN2A

TP53 c.734 G > A (p.G245D)

Chromosome 17p arm level loss (including TP53)

Case 2

SMARCA4 c.4741 G > A (p.G1581S)d

SMARCA4 c.526 C > T (p.Q788R)

SMARCA4 c.2363 A > G (p.Q176*)

Absent

9p21.3 single copy deletion of CDKN2A

Rectum

(n = 1)

SMARCA4 c.1603G > T (p.E535*)e

SMARCA4 C.4318 C > T (p.Q1440*)

Absent

9p21.3 two copy deletion of CDKN2A

Gallbladder (n = 1)

SMARCA4 c.3383-3_3411delf

CAGGAACCACGAAGGCGGAGGACCGGGGCATG

SMARCA4 intron 25 (chr19:11141402):: SMARCA4 exon 26 (chr19:11141434) deletion

Absent

9p21.3-p24.3 single copy deletion of CDKNA2

TP53 c.637 C > T (p.R213*)

  1. *Denotes the introduction of a STOP codon.
  2. aCutaneous case 1: These two SMARCA4 nonsense variants are predicted to confer biallelic inactivation.
  3. bCutaneous case 2: The nonsense variant and frameshift mutation leading to a splice site variant in SMARCA4 likely confer biallelic inactivation.
  4. cLung case 1: SMARCA4 splice site mutation predicted to lead to loss of function. Lung case 2: SMARCA4 frameshift variant predicted to lead to loss of function and chromosome 19p arm level loss including the SMARCA4 locus. Lung case 3: Two copy deletion of SMARCA4 in exons 2-7 causing loss of function. Lung case 4: Two copy deletion of SMARCA4 in exons 4-11 causing loss of function.
  5. dEsophagus case 1: Biallelic inactivation of SMARCA4 resulting from a nonsense alteration and a 25 base pair deletion frameshift alteration (SMARCA4 p.Gln356Argfs*47). Esophagus case 2: One nonsense mutation (p.Q176) and two missense mutations likely lead to SMARCA4 loss of function.
  6. eRectal case: These two nonsense variants likely lead to biallelic loss of function of SMARCA4.
  7. fGallbladder case: SMARCA4 splice site deletion and SMARCA4 intron 25 (chr19:11141402):: SMARCA4 exon 26(chr19:11141434) deletion imply biallelic SMARCA4 inactivation.
Back to article page