Table 1 Bacterial strains, plasmids, abbriviations for recombinant strains and primers used in this study

From: E. coli Nissle 1917 is a safe mucosal delivery vector for a birch-grass pollen chimera to prevent allergic poly-sensitization

a) Strains and plasmids

Description

Reference

 Lactococcus lactis MG1363

Plasmid free

23

 Lactobacillus plantarum NCIMB8826

Originally isolated from human saliva

NCBI

 Escherichia coli MC1061

araD139 Δ(ara–leu)7696 lacX74 galV galK hsr–hsm rpsL

Invitrogen

 Escherichia coli Nissle 1917

Originally isolated from human intestine by Alfred Nissle

46

 E. coli BL21

Competent E. coli for cloning

New England Biolabs

 pNZ8148

L. lactis pSH71 replicon, Chloramphenicol resistance; Cmr

MoBiTech

 pHis Parallel 2-Chim

pHis Parallel 2 carrying a cDNA of birch-grass pollen chimer consisting Bet v 1 as scaffold and the immunodominant peptides of Phl p 1 and Phl p 5 were linked to the N and C-terminus of Bet v 1 under inducible nisR and nisK promoter.Cmr

8

 pMEC275

pNZ8148 carrying fluorescent mCherry cDNA codon optimized for L. plantarum fused to L. plantarum PldhL (lactate dehydrogenase) constitutive promoter. Cmr

Daniel et al. in preparation

 pMEC275-Chim

pNZ8148 carrying codon optimized g-blocks birch-grass pollen chimer (Phl p 5-Bet v 1-Phl p 1) optimized for E. coli Nissle codon and mCherry as a reporter gene fused to constitutive PldhL promoter. Cmr

Present study

 pMEC256-CBRluc

pNZ8148 carrying CBRluc cDNA codon optimized for L. plantarum fused to PldhL promoter. Cmr

23

b) Abbreviations for strains

Details

 EcN

Escherichia coli Nissle 1917 original strain – in vitro studies

Present study

 EcN-Chim

E. coli Nissle expressing birch-grass pollen chimer + mCherry - in vivo studies

Present study

 EcN-Ctrl

E. coli Nissle expressing mCherry as a control strain - in vitro and in vivo studies

Present study

 EcN-CBRluc

E. coli Nissle expressing CBRluc a luciferase gene –in vivo imaging studies

Present study

 Lp-CBRluc

L. plantarum expressing CBRluc a luciferase gene - in vivo imaging studies

Present study

c) Name of primer

Sequence

 Phl_p5_Betv1a_Phl_p1_Ec_F (Nco)

ATGATGCCATGGCGTACGCTGCTACTGT

Present study

 Phl_p5_Betv1a_Phl_p1_Ec_RBS_R (Nco)

CTCATGCCATGGTAATTCCTCCTTTGATTACACCTTCGTGCCTTCCG

Present study

 Betv1a_Ec_screen_R

ACAGGTTATCACCGTCCAGG

Present study

 pMEC181_seq_F

ATGACGTGTCTGGGCATATTG

Present study

 pMEC248_seq_R

TAACAGACAACATCTTCGCTGC

Present study

  1. a) All wild type strains and plasmids used in this study. b) abbreviations and details of recombinant strains used in this study. c) Primers used in this study. All primers restriction and modifying enzymes, as well as Q5 DNA polymerase and Taq polymerase were purchased from New England Biolabs (NEB). PCR products were purified using the NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Germany).
  2. Cmr: resistance to chloramphenicol
Back to article page