Fig. 4: RB1CC1 induces PSC activation via binding to ULK1 promoter and the direct interaction with ULK1 protein. | Cell Death & Disease

Fig. 4: RB1CC1 induces PSC activation via binding to ULK1 promoter and the direct interaction with ULK1 protein.

From: RB1CC1-enhanced autophagy facilitates PSCs activation and pancreatic fibrogenesis in chronic pancreatitis

Fig. 4

a Western blot analyses were assessed to reveal the expressions of RB1CC1, ULK1, p-ULK1, α-SMA, P62, and LC3II/I in quiescent, activated, sh-RB1CC1 and sh-RB1CC1 plus TGF-β groups. GAPDH served as the internal control. b The expressions of RB1CC1, ULK1, p-ULK1, α-SMA, P62 and LC3II/I were measured by Western blot assays in quiescent, TGF-β, pcDNA3.1 encoding RB1CC1 and pcDNA3.1 encoding RB1CC1 plus TGF-β groups. c, d The mRNA levels of RB1CC1 and α-SMA were tested by qRT-TCR assays in different groups. e, f The relative expressions of Collagen I and Collagen III were determined via qRT-TCR assays. g The Co-IP analyses were performed and the relative enrichments of RB1CC1 or ULK1 were determined by western blot assays in Input, IgG, and ULK1 or RB1CC1 groups. h, i Luciferase assays indicated that RB1CC1 could bind with ULK1 promoter and regulated its transcription. j Electrophoretic mobility shift assay (EMSA) was carried out using biotinylated DNA oligos containing the RB1CC1-binding site (CTTTTTTTATAAAACACAACA) in the ULK1 promotor. Data are expressed as mean ± SD. The results are representative of three independent experiments (*p <0.05, **p <0.01 and ***p <0.001)

Back to article page