Table 1 The mutation rates of multiplexed genome editing by LrCas9 in rice T0 lines
From: Efficient plant genome engineering using a probiotic sourced CRISPR-Cas9 system
No. | Site | Target gene | Protospacer + PAM | Tested T0 lines | Mutated T0 lines (number; ratio) | Biallelic T0 lines (number; ratio) | Deletion T0 lines (number; ratio) |
|---|---|---|---|---|---|---|---|
pZHZ741 | Os-AG04 | OsPDS | AGTCCTGGCAAACAACCTGCAGAAA | 23 | 7; 30.4% | 3; 13.0% | – |
Os-CG01 | OsDEP1 | TCCCGAGCGCGGAGTACGTACGAAA | 12; 52.2% | 11; 47.8% | – | ||
pZHZ742 | Os-TG01 | OsPDS | CTAGCCAAGCTATTTCCTGATGAAA | 27 | 23; 85.2% | 22; 81.5% | 4; 14.8% |
Os-TG02 | OsPDS | TGGCATTTCTACCTTATCGATGAAA | 19; 70.4% | 8; 29.6% |
