Fig. 8: The GTGA to TGAG mutation in the promoter of RNA5P affects its expression and DON biosynthesis. | Nature Communications

Fig. 8: The GTGA to TGAG mutation in the promoter of RNA5P affects its expression and DON biosynthesis.

From: Regulation of TRI5 expression and deoxynivalenol biosynthesis by a long non-coding RNA in Fusarium graminearum

Fig. 8

a Schematic drawing of the genomic region of RNA5P and the gene replacement event to introduce the GTGA (underlined) to TGAG mutation at the Tri6-binding site in its promoter. The overlapping PCR products amplified with labeled PCR primers containing the TCACGGGCTACATGAGATGTTCGTGA sequence were transformed into the TRI5Δpromoter transformant (T5P) to generate the TRI5M6B transformants carrying the GTGA to TGAG mutation. P, TrpC promoter; T, CaMV ployA signal terminator. b The expected sizes of fragments could be amplified with primer pairs T5P-F and T5Y-8R from genomic DNA of the wild type and two independent TRI5M6B transformants (TM6 and TM66), but not the T5P strain (upper panel). M, molecular marker. The GTGA-to-TGAG mutation in TM6 and TM66 strains was verified by Sanger sequencing of the PCR products (lower panel). The mutations are marked with red stars. The experiment was repeated three times independently with similar results. c Relative expression levels of RNA5P, TRI5, and antisense-TRI5 in LTB cultures of PH-1 (arbitrarily set to 1) and two independent TRI5M6B transformants (TM6 and TM66) carrying the GTGA to TGAG mutation. d DON production in LTB cultures of PH-1 and two independent TRI5M6B transformants (TM6 and TM66). e A proposed model for the role of Tri6-binding on RNA5P expression. In the wild type, binding of Tri6 is inhibitory to RNA5P expression, leading to TRI5 expression under DON-producing conditions. In the mutant with the GTGA-to-TGAG mutation that eliminates Tri6-binding, elevated RNA5P expression results in the suppression of TRI5 expression. For c and d, mean and standard deviation were estimated with data from three (n = 3) independent replicates (marked with black dots on the bars). For DON production, different letters indicate significant differences based on one-way ANOVA followed by Turkey’s multiple-range test. Differences were considered statistically significant when p-value is <0.05. The exact p-values are shown in the Source Data file.

Back to article page