Table 3 Strains and primers required for knockdown of luxS gene

Material	General characteristics	Source/purpose/reference
Strain
ATCC13813	WT GBS	Purchased from ATCC website
ΔGBS	ATCC13813ΔLuxS: Erm	Mutant, constructed in this study, ErmR
DH5α	Escherichia coli Clone host strain	Takara Biotechnology (Dalian) Co., Ltd
Plasmid
pSET4s	Thermosensitive suicide vector, SpeR	Takamatsu et al. ⁷⁵
pJDC9	Insertion vector, ErmR	JD Chen et al. ⁷⁴
pSET4s-luxS	Suicide vector, temperature-sensitive, ErmR and SpeR	pSET4s carrying the luxS-up, Erm and luxS-down fragments. Constructed in this study
Primer	Sequence (5’ − 3’)
LuxS-upF	tgaattcgagctcggtacccgtttagcttcttcttgactaagc	amplification of the upstream of luxS
LuxS-upR	ccgtcttatctcccattatatcaagttttctccttttgtattacattc	amplification of the upstream of luxS
LuxS-downF	acgggaggaaataattctatgtctaataaaaaataaaagtcaacttttgg	amplification of the downstream of luxS
LuxS-downR	gcaggtcgactctagaggatccccttaatactggtaatgctagtctag	amplification of the downstream of luxS
Erm-F	tgtaatacaaaaggagaaaacttgatataatgggagataagacgg	erm gene amplification
Erm-R	ccaaaagttgacttttattttttattagacatagaattatttcctcccgt	erm gene amplification
pSET4s-F	tagactagcattaccagtattaaggggatcctctagagtcgacctgc	pSET4s amplification
pSET4s-R	gcttagtcaagaagaagctaaacgggtaccgagctcgaattcact	pSET4s amplification
M13-F	gtaaaacgacggccagt	Fusion of pSET4S, luxS-up, Erm and luxS-down
M13-R	aacagctatgaccatg	Fusion of pSET4S, luxS-up, Erm and luxS-down
Lux-F	atgacaaaagaagttgtcgt	Detection of the mutant
Lux-R	tcagacaatgtggcgc	Detection of the mutant

The fragments luxS-up (701 bp), erm (965 bp), luxS-down (719 bp) and pSET4s (4506) were amplified by PCR using the primers luxS-upF/luxF-upR, Erm-F/Erm-R, luxS-downF/luxS-downR and pSET4s-F/pSET4s-R, respectively. The primers designed according to the sequences of the pSET4s plasmid and genome of the WC1535 GBS strain (Accession number NZ_GL636070). PCR amplification conditions were as follows: initial denaturation at 94 °C for 3 min; 26 cycles of 94 °C for 30 s, 59 °C for 30 s and 68 °C for 1–3 min; and final extension at 68 °C for 5 min.

Search