Table 3 Strains and primers required for knockdown of luxS gene
From: Mechanisms of S. agalactiae promoting G. vaginalis biofilm formation leading to recurrence of BV
Material | General characteristics | Source/purpose/reference |
|---|---|---|
Strain | ||
 ATCC13813 | WT GBS | Purchased from ATCC website |
 ΔGBS | ATCC13813ΔLuxS: Erm | Mutant, constructed in this study, ErmR |
 DH5α | Escherichia coli Clone host strain | Takara Biotechnology (Dalian) Co., Ltd |
Plasmid | ||
 pSET4s | Thermosensitive suicide vector, SpeR | Takamatsu et al. 75 |
 pJDC9 | Insertion vector, ErmR | JD Chen et al. 74 |
 pSET4s-luxS | Suicide vector, temperature-sensitive, ErmR and SpeR | pSET4s carrying the luxS-up, Erm and luxS-down fragments. Constructed in this study |
 Primer | Sequence (5’ − 3’) |  |
 LuxS-upF | tgaattcgagctcggtacccgtttagcttcttcttgactaagc | amplification of the upstream of luxS |
 LuxS-upR | ccgtcttatctcccattatatcaagttttctccttttgtattacattc | amplification of the upstream of luxS |
 LuxS-downF | acgggaggaaataattctatgtctaataaaaaataaaagtcaacttttgg | amplification of the downstream of luxS |
 LuxS-downR | gcaggtcgactctagaggatccccttaatactggtaatgctagtctag | amplification of the downstream of luxS |
 Erm-F | tgtaatacaaaaggagaaaacttgatataatgggagataagacgg | erm gene amplification |
 Erm-R | ccaaaagttgacttttattttttattagacatagaattatttcctcccgt | erm gene amplification |
 pSET4s-F | tagactagcattaccagtattaaggggatcctctagagtcgacctgc | pSET4s amplification |
 pSET4s-R | gcttagtcaagaagaagctaaacgggtaccgagctcgaattcact | pSET4s amplification |
 M13-F | gtaaaacgacggccagt | Fusion of pSET4S, luxS-up, Erm and luxS-down |
 M13-R | aacagctatgaccatg | Fusion of pSET4S, luxS-up, Erm and luxS-down |
 Lux-F | atgacaaaagaagttgtcgt | Detection of the mutant |
 Lux-R | tcagacaatgtggcgc | Detection of the mutant |