Extended Data Fig. 7: IFIT2-IFIT3 binds to host transcripts with short 5’ UTRs, which can sensitize a reporter to IFIT2-IFIT3-mediated inhibition, related to Fig. 5.
(a) Fraction of all host transcripts (n ≥ 10,000 from RNAseq data) that eCLIP (greater than 3 in log10p and log2fc) with the indicated IFIT in VSV infected IFIT-overexpressing HEK293 cells. Transcripts with IFIT eCLIP signal in the 5’ end of the transcript are shown. Each replicate is shown as a point, with the average indicated by a line. (b) Fraction of all host transcripts (circles) or host transcripts with 5’ UTR lengths <50 nt ( ~ 11% of all host transcripts) (squares) that are bound in VSV infected IFIT2-IFIT3 overexpressing cells. As in panel a, transcripts with IFIT eCLIP signal in the 5’ end of the transcript are also shown. Individual replicates (combined from both IFIT2 and IFIT3 pulldowns) are shown as points, with the average value shown as a line. (c) Coverage of three short 5’ UTR-containing human genes (top: H4C8, 5’ UTR AGGUUUCUUAAGUUGGUUUUAGAAGUUGCUUAGUC; middle: H2BC5, 5’ UTR AUUAUUUUCUCAGGUGUUUGCAACAGUGUUCUAACUAUUAACGCUACG; bottom: MRPL54, 5’ UTR AAGCUGCCCGCAAUACGUC) from the eCLIP experiment described in Fig. 4a-b. Values shown are normalized reads per million (RPM) out of all reads mapped to the human genome. (d) HEK293T cells were transfected with GFP expression plasmids containing the indicated human 5’ UTRs from panel c in the absence or presence of co-transfected IFIT2-IFIT3. Experiments were performed as in Fig. 5e. Statistical analyses: Data are represented as mean ± SEM. (b, d) Ordinary two-way ANOVA with Šídák’s multiple comparisons test and a single pooled variance. * = p < 0.05, **** = p < 0.0001.
