Fig. 3: TR DNMs show motif-size-dependent mutation rates, paternal bias and are highly recurrent at specific loci.

a, TR DNM rates (mutations per haplotype per locus per generation) are displayed for each TR class (STR, VNTR or complex) as a function of the minimum motif size observed at each TR locus (n = 522) in the T2T-CHM13 reference genome (blue; left y axis).The average number of loci of each motif size that passed filtering criteria in each individual are displayed in grey (right y axis). The error bars denote the 95% Poisson CIs (computed using a χ² distribution) around the mean mutation rate estimate. The mutation rates include all non-recurrent calls that pass TRGT-denovo filtering criteria and Element consistency analysis. b, The inferred parent-of-origin for confidently phased TR DNMs in G3. The hatching indicates transmission to at least one G4 child, where available. c, Pedigree overview of a recurrent VNTR locus at chromosome 8: 2376919–2377075 (T2T-CHM13) with motif composition GAGGCGCCAGGAGAGAGCGCT(n)ACGGG(n). Allele colouring indicates inheritance patterns as determined by inheritance vectors, with grey representing unavailable data. The symbols denote inheritance type relative to the inherited parental allele: plus (+) for de novo expansion and minus (−) for de novo contraction, shown only for the mutating alleles; the numbers indicate allele lengths in bp. De novo TR alleles are present in seven out of eight G3 individuals and transmit to four G4 individuals, with two expanding further after transmission. The spouse of a G3 individual (200080) carries a distinct TR allele that undergoes a de novo contraction in subsequent transmissions. d, Read-level evidence for the recurrent DNM in c, represented as vertical lines, obtained from individual sequencing reads, shown per sample. Where available, both HiFi (top) and ONT (bottom) sequencing reads are displayed. Colouring is consistent with the inheritance patterns in c; the outlined boxes with plus or minus markers highlight DNMs.