Supplementary Figure 4: PAX5 internal tandem duplication (ITD) of exons 2–5.

a, PAX5-ITD (PAX5amp) detected by whole genome sequencing (WGS) in Integrative Genomics Viewer (Robinson, J.T. et al., Nat Biotechnol 29, 24-6,2011). Upper scatter plot shows WGS coverage relative to the germline sample. The genomic region with elevated copy number is highlighted by a red bar. The red arc denotes a tandem duplication encompassing PAX5 exons 2–5. Transcriptome sequencing coverage from the same sample is shown as a blue histogram and elevated expression of gained exons is shown. Below are the aligned WGS reads, and the discordant pairs are shown in red, supporting the structural variation. b, Wild-type and mutant PAX5 with amplified exons (e) 2–5. Primers (shown as arrows) were designed to amplify the fragments with the 5ʹ end in exon 5 and 3ʹ in exon 2 (primer e5: GACACCAACAAGCGCAAGAGAGAC; e2: TGATGAGCAAGTTCCACTATCCTC). c, Representative electropherogram of Sanger sequencing showing the junction of exon boundaries characterizing the duplication of exons 2–5. d, Fluorescent in-situ hybridization (FISH) confirming the presence of a PAX5 (exons 2–5) tandem duplication. Duplication is indicated by paired red signals (PAX5 exons 2–5 fosmid clone) associated with a green signal (chromosome 9 control probe). Sixty-three percent of analyzed cells were determined to be positive for the PAX5 duplication. A FISH validation in normal metaphase cells confirming the localization is shown on the left panel.