Supplementary Figure 2: Sequence and structure of bio-Pup(E) and bio-DE28.

(a) The sequence of bio-Pup(E). BCCP domain (blue) derived from bacteria carboxylase (Propionobacterium freednreichii, NCBI Reference Sequence: WP_013161729.1) is fused to the N terminus of full length Pup (red). BCCP has been codon optimized for mammalian cell expression (DNA sequence: GCCGGGAAGGCAGGCGAGGGAGAGATCCCCGCACCCTTGGCCGGCACGGTCAGCAAAATCCTGGTCAAGGAAGGCGACACCGTGAAGGCTGGACAGACGGTGTTGGTACTGGAGGCGATGAAGATGGAGACAGAGATCAATGCCCCGACCGATGGGAAGGTGGAGAAGGTGCTGGTTAAGGAGAGGGACGCCGTGCAGGGCGGTCAGGGACTGATCAAGATCGGCGACTACGACATCCCGACAACCGCCAGC). The lysine residue labeled in green is biotinylated in mammalian cells. This version of bio-Pup(E) was used for all intracellular studies in the paper. (b) Recombinant bio-Pup(E) purified from E. Coli. GST-bio-Pup(E) was cloned into pGEX vector. The protein was pull down by GST tag, then GST was cleaved off and the protein was further purified with gel filtration chromatography. * Residual GST left in the sample. (c) The structure and design of chemically synthesized bio-DE28. (d) Mass spectrometry analysis of confirmed peptide mass. (e) Bio-Pup(E) and bio-DE28 have similar activity in vitro. The Puplylation assay was carried out in a 20 μl reaction mix containing 200 nM GST-PafA, 10x reaction buffer (200 mM Tris, 50 mM ATP and 75 mM Mg²⁺, pH 8.0), and 2 μM bio-Pup(E) or bio-DE28 at 25 °C. The reactions were stopped at different time points for western blot analysis with streptavidin-HRP. The intensity of self-modified GST-PafA were quantitated and plotted (mean ± SEM on the bottom left and individual dots plot on the bottom right, n = 3 independent experiments). One representative gel from triplicate experiments was shown on the top. Original full scans of blots are shown in Supplementary Fig. 15.