Figure 1
From: MAOA variants differ in oscillatory EEG & ECG activities in response to aggression-inducing stimuli
Genomic structure of the MAOA uVNTR polymorphism. (a) Nucleotide sequence alignment of the MAOA uVNTR alleles 2.5R, 3.5R, and 4.5R. 1R of each MAOA uVNTR allele consisted of a 30 bp “ACCGGCACCGGCACCAGTACCCGCACCAGT” sequence, followed by the first half-sequence of “ACCGGCACCGGCACC” in the last 0.5R. (b) Visualization of the different MAOA genotypes of the Korean population in 3% agarose gel. Lanes 1 and 2 are 3.5R/Y and 4.5R/Y from men; lanes 3, 4, 5, 6 and 7 are 3.5R/3.5R, 4.5R/4.5R, 2.5R/3.5R, 2.5R/4.5R, and 3.5R/4.5R from women, respectively. The full gel is presented in Fig. S7a.
