Table 6 Prediction of gene specific MiRNA-targets associated with oral cancer.
From: Systems-level differential gene expression analysis reveals new genetic variants of oral cancer
Serial no | Gene symbol | Gene description | *Target score | microRNA name | Total hits | miRNA sequence | Seed location | 3′-UTR length |
|---|---|---|---|---|---|---|---|---|
1 | CYP1A1 | cytochrome P450 family 1 subfamily A member 1 | 90 | hsa-miR-4786-5p | 35 | UGAGACCAGGACUGGAUGCACC | 735 | 966 |
2 | CYP1B1 | cytochrome P450 family 1 subfamily B member 1 | 98 | hsa-miR-4282 | 141 | UAAAAUUUGCAUCCAGGA | 19, 704, 1,092, 1,235, 1,246, 1753, 2028, 2,137 | 3,125 |
3 | C7 | complement C7 | 97 | hsa-miR-2052 | 84 | UGUUUUGAUAACAGUAAUGU | 1,197, 1,203, 1,311 | 3,073 |
4 | ADCY2 | adenylate cyclase 2 | 96 | hsa-miR-216a-3p | 142 | UCACAGUGGUCUCUGGGAUUAU | 190, 1575, 1641, 2,853 | 3,210 |
5 | SERPINB5 | serpin family B member 5 | 98 | hsa-miR-3148 | 64 | UGGAAAAAACUGGUGUGUGCUU | 169, 196, 1,323 | 1,363 |
6 | ANAPC13 | anaphase promoting complex subunit 13 | 89 | hsa-let-7f-1-3p | 61 | CUAUACAAUCUAUUGCCUUCCC | 699 | 903 |
