Table 1 qPCR primer set (murine) of all reference genes tested, contrasting the top-ranked generally applied (bold = applied in all tissues) and the tissue-specific (unbold = applied in selected tissues) candidates.
Symbol | Gene name | Protein function | Primer sequence (F: 5′-3′/R: 3′-5′) |
|---|---|---|---|
Actb | Actin beta | Structural protein of the cytoskeleton, involved in cell structure, integrity, motility and intercellular signalling | F: TTGCTGACAGGATGCAGAAG R: GTACTTGCGCTCAGGAGGAG |
B2m | Beta-2-microglobulin | Component of the class I major histocompatibility complex (MHC), involved in the presentation of peptide antigens to the immune system | F: TCTCACTGACCGGCCTGTAT R: GATTTCAATGTGAGGCGGGTG |
Gapdh | Glyceraldehyde-3-phosphate dehydrogenase | Catalyses of the reversible oxidative phosphorylation in glycolysis and gluconeogenesis; participates in nuclear events incl. transcription, RNA transport, DNA replication and apoptosis | F: ACTGAGCAAGAGAGGCCCTA R: TATGGGGGTCTGGGATGGAA |
Hprt | Hypoxanthine phospho-ribosyltransferase 1 | Transferase that catalyses a central reaction in the synthesis of purine nucleotides | F: GGTTAAGCAGTACAGCCCCA R: GGCCTGTATCCAACACTTCG |
Ppia | Peptidylprolyl Isomerase A or Cyclophilin A | Catalyses the cis–trans isomerisation of proline imidic peptide bonds in oligopeptides and accelerates the protein folding | F: CCACCGTGTTCTTCGACATC R: CTGGCACATGAATCCTGGAA |
Hmbs | Hydroxymethylbilane synthase | Third enzyme of the haem biosynthetic pathway | F: ATGAGGGTGATTCGAGTGGG R: TTGTCTCCCGTGGTGGACATA |
Psmb2 | Proteasome subunit Beta 2 | Component of the 20S core proteasome complex, involved in the proteolytic degradation of most intracellular proteins | F: ATGTGTTGGAGAGGCTGGAG R: AAGTTAGCTGCTGCTGTGGG |
Rplp0 | Ribosomal protein lateral stalk subunit P0 | A component of the large 60S subunit of the ribosome | F: TTTGACAACGGCAGCATTTA R: GTACCCGATCTGCAGACACAC |
Srsf4 | Serine and arginine rich splicing factor 4 | Involved in mRNA processing | F: TTGTGGAGAATTTGTCAAGTCG R: GTTTTTGCGTCCCTTGTGAG |
Tbp | TATA-box binding protein | General transcription factor, involved in the initial transcriptional step of the pre-initiation complex followed by RNA polymerase II activation | F: CCAGAACAACAGCCTTCCAC R: GTGGAGTAAGTCCTGTGCCG |
