Table 2 qPCR primer set (murine) of all target genes tested.
Symbol | Gene name | Protein function | Primer sequence (F: 5′-3′/R: 3′-5′) |
|---|---|---|---|
ApoE | Apolipoprotein E | Major apoprotein of the chylomicron, essential for the normal catabolism of lipoprotein constituents with triglycerides | F: TGGTGTTCAAAGACAATTTTTCCCT R: CCACTCGAGCTGATCTGTCAC |
Atf4 | Activating transcription factor 4 | Transcription factor, also characterised as the cAMP-response element binding protein 2 (Creb2) | F: CACTGGCGAGTGTAAGGAGC R: TTCTTCCCCCTTGCCTTACG |
Creb1 | cAMP responsive element binding protein 1 | Phosphorylation-dependent transcription factor | F: CCCTGCCATCACCACTGTAA R: GGTTAATGTCTGCAGGCCCT |