Table 4 Oligonucleotide sequences of primers and probe designed for the RABV-RPA assay.
From: A recombinase polymerase amplification assay for rapid detection of rabies virus
Name | Type | Length (bp) | Sense | Sequence 5′–3′ | Gene | Positiona | Product size (bp) |
---|---|---|---|---|---|---|---|
RPA_N_FP2C | Primer | 35 | Forward | GCATCCTTAGTCGGTCTGCTCTTGAGTCTGTATAG | N | 482–516 | 133 |
Exo_probe_N | Probe | 45 | Reverse | CTATCCGATCTGCAA[BHQ-dT][THF][FAM-dT]TTGTCTTGTAGTTGCCTGTGTTTTGTCCTG–Ph | N | 531–578 | |
RPA_N_RP4C3P | Primer | 32 | Reverse | CAATTTTAACGAAAGGGGCTGTCTCAAAAATC | N | 583–614 |