Table 1 Key resource table.
From: Recycling of endocytic BDNF through extracellular vesicles in astrocytes
Reagent type or resources | Source or reference | Identifiers | Additional information |
|---|---|---|---|
Antibodies | |||
Rabbit polyclonal anti-Rab5 | Abcam | ab13253 | IF 1:200 |
Mouse monoclonal anti-EGFP | Thermo Fisher Scientific | MA1-952 | IB 1:800 |
Mouse monoclonal anti-Calregulin | Santa Cruz Biotechnology | sc-373863 | IB 1:100 |
Mouse monoclonal anti-TSG101 | Santa Cruz Biotechnology | sc-7964 | IB 1:100 |
Mouse monoclonal anti-CD63 | Santa Cruz Biotechnology | sc-5275 | IF 1:100 |
Rabbit polyclonal anti-Rab11 | Santa Cruz Biotechnology | sc-9020 | IF 1:150 |
Goat anti-mouse IgG (H + L) Alexa Fluor 488 | Thermo Fisher Scientific | A11029 | IF 1:100 |
Goat anti-rabbit IgG (H + L) Alexa Fluor 488 | Thermo Fisher Scientific | A11034 | IF 1:100 |
Mouse IgG1 Isotype Control | Thermo Fisher Scientific | MA1-10,406 | Â |
Mouse monoclonal anti-FLAG | Thermo Fisher Scientific | F1804 | IB 1:10,000 |
Rabbit monoclonal anti-V5 | Cell signaling | 13,202 | IB 1:5,000 |
HRP-conjugated anti-mouse antibody | Bio-Rad | 1,706,516 | IB 1:10,000 |
HRP-conjugated anti-rabbit antibody | Bio-Rad | 1,706,515 | IB 1:10,000 |
Virus strains and DNA | |||
Lenti-GFAP-EGFP | This paper | N/A | Â |
Lenti-GFAP-TurboID-KDEL | Â | Â | Â |
pCAG-CD63-V5-EGFP | Â | Â | Â |
pCAG-BDNF-EGFP | Â | Â | Â |
pCMV-EGFP-3xflag-Vamp3 | Â | Â | Â |
pCMV-EGFP-Rab11a | Addgene | 12,674 | Gift from Richard Pagano |
Oligonucleotides | |||
siSCR-sense: UAAGGCUAUGAAGAGAUACUU | Ref.10 | N/A | Â |
siSCR-antisense: AAGUAUCUCUUCAUAGCCUUA | Â | Â | Â |
siVamp3-sense: CCAAGUUGAAGAGAAAGUAUU | Â | Â | Â |
siVamp3-antisense: AAUACUUUCUCUUCAACUUGG | Â | Â | Â |
Strains | |||
Mouse: C57BL/6N | Koatech Co., Korea | N/A | Â |
Chemicals and solutions | Â | Â | Â |
Penicillin‒Streptomycin (5,000 U/mL) | Thermo Fisher Scientific | 15,070,063 |  |
Protein G plus-agarose | Santa Cruz Biotechnology | sc-2002 | Â |
GlutaMAX Supplement | Thermo Fisher Scientific | 35,050,061 | Â |
L-Glutamine | Thermo Fisher Scientific | 25,030,081 | Â |
Triton X-100 | Sigma‒Aldrich | X100 |  |
Protease inhibitor cocktail | Quartett | PPI1015 | Â |
EZ-Western Lumi Femto Kit | Dogenbio | DG-WF200 | Â |
GW4869 | Santa Cruz Biotechnology | sc-218578 | Â |
HEPES | Thermo Fisher Scientific | 15,630,080 | Â |
HBSS | Thermo Fisher Scientific | 14,170,112 | Â |
Trypsin–EDTA (0.25%), phenol red | Thermo Fisher Scientific | 25,200,056 |  |
B-27 Supplement (50 ×), serum-free | Thermo Fisher Scientific | 17,504,044 |  |
Penicillin–streptomycin (5000 U/mL) | Thermo Fisher Scientific | 15,070,063 |  |
Neurobasal medium | Thermo Fisher Scientific | 21,103,049 | Â |
Poly-L-lysine solution | Sigma‒Aldrich | P4707 |  |
Polyethylenimine (PEI) | Sigma‒Aldrich | P3143 |  |
Fetal bovine serum, ultra-low IgG | Thermo Fisher Scientific | 16,250–078 |  |
DMEM | HyClone | SH30243.01 | Â |
MEM | Thermo Fisher Scientific | 11,095,080 | Â |
Opti-MEM | Thermo Fisher Scientific | 31,985,070 | Â |
HBEGF | Sigma‒Aldrich | E4643 |  |
Lipofectamine 2000 | Thermo Fisher Scientific | 11,668,027 | Â |
Human BDNF-biotin | Alomone Labs | B-250-B | Â |
Bovine serum albumin (BSA), biotinylated | Vector Laboratories | B-2007 | Â |
Qdot 655 streptavidin conjugate | Thermo Fisher Scientific | Q10121MP | Â |
QSY 21 carboxylic acid, succinimidyl ester | Thermo Fisher Scientific | Q20132 | Â |
4% Paraformaldehyde solution (PFA) | Biosesang | PC2031-100–00 |  |
Normal goat serum | Jackson ImmunoResearch | 005–000-121 |  |
Normal donkey serum | Jackson ImmunoResearch | 017–000-121 |  |
MitoTracker red CMXRos | Thermo Fisher Scientific | M7512 | Â |
Mounting medium | Vector Laboratories | H-1400–10 |  |
Adenosine 5′-triphosphate magnesium salt (ATP) | Sigma‒Aldrich | A9187 |  |
Potassium chloride | Sigma‒Aldrich | 529,552 |  |
DPBS | Thermo Fisher Scientific | 14,190,136 | Â |
Polyethylene glycol (PEG) | Sigma‒Aldrich | 81,260 |  |
Dimethyl sulfoxide (DMSO) | Sigma‒Aldrich | D8418 |  |
Tween 20 | Sigma‒Aldrich | P9416 |  |
Skim milk powder | Sigma‒Aldrich | 70,166 |  |
Software and Algorithms | |||
ImageJ | Â | Â | |
Prism 8.0 | Sigma‒Aldrich | N/A |  |
Others | |||
100 μm cell strainer | BD Falcon | 352,360 |  |
Amicon Ultra-0.5 centrifugal filter unit | Sigma‒Aldrich | UFC510096 |  |
Amicon Ultra-15 Centrifugal Filter Unit | Sigma‒Aldrich | UFC901024 |  |
0.22 µm syringe filter | Merck | SLGP033RB |  |
Glass-bottom dish | SPL | 101,350 | Â |
4–20% Mini-PROTEAN® TGX Stain-Free | Bio-Rad | 4,568,093 |  |
NT Nitrocellulose Transfer Membrane | fisher scientific | 66,485 | Â |
EV isolation Kit CD63, mouse | Miltenyi Biotec | 130–117-041 |  |
Bdnf (Mouse) ELISA Kit | Abnova | KA0331 | Â |
GFP ELISA Kit | Cell Biolabs | ARK-121 | Â |
