Fig. 1 | Scientific Reports

Fig. 1

From: Impact of LIN7A silencing on U87 cell invasion and its clinical significance in glioblastoma

Fig. 1

LIN7A gene silencing and validation. (A) Design of lentiviral vectors for LIN7A gene silencing: five distinct lentiviral vectors were designed to target the LIN7A gene, with corresponding empty vectors serving as controls. These vectors were used to transfect U87 cells at two different multiplicities of infection (MOIs), 1:10 and 1:100. The efficacy of gene silencing was assessed using quantitative reverse transcription polymerase chain reaction (RT-qPCR), which allowed for the selection of the most effective vector. The selected vector’s clone ID is NM_004664.2-710s1c1 (TRCN0000116870-CCGGGAACTACTCAAGGCTGCTAAACTCGAGTTTAGCAGCCTTGAGTAGTTCTTTTTG). (B) Western blotting for confirmation of LIN7A gene silencing: western blot analysis was performed to confirm the efficiency of LIN7A gene silencing. The LIN7A protein band appeared at approximately 26 kDa, while the α-tubulin band, used as a loading control, was observed at 55 kDa. (C) Quantitative analysis of LIN7A expression: quantitative analysis of the western blot bands was conducted using ImageJ software. The analysis revealed a significantly higher intensity of the LIN7A band in U87Ctrl cells compared to U87shLIN7A cells (*P < 0.05), confirming the successful silencing of LIN7A in U87shLIN7A cells. (D,E) Immunofluorescence staining of LIN7A protein expression: immunofluorescence staining was performed to visualize LIN7A protein expression in U87 cells. In U87Ctrl cells (D), LIN7A protein was primarily localized to cell junctions, as indicated by green staining, while nuclei were stained blue. In contrast, LIN7A expression was significantly reduced and lost its typical localization in U87shLIN7A cells (E), confirming successful gene silencing at the protein level. Additionally, as indicated by the yellow arrows, the cell junctions in U87Ctrl cells were intact, whereas those in U87shLIN7A cells appeared unclear, suggesting disruption and compromised integrity of the cell junctions.

Back to article page