Table 1 List of sequences of forward and reverse primers.
From: Beta-cell regeneration from vimentin+/MafB+ cells after STZ-induced extreme beta-cell ablation
Genes | Primer Sequences | Product size (bp) |
|---|---|---|
Ins1 | Forward: 5′->3′ggaacgtggtttcttctacac Reverse: 5′->3′gggagtggtggactcag | 216 |
Ins2 | Forward: 5′->3′tcttctacacacccatgtccc Reverse: 5′->3′ggtgcagcactgatccac | 149 |
Pdx1 | Forward: 5′->3′gacacatcaaaatctggttccaaa Reverse: 5′->3′tcccgctactacgtttcttatcttc | 75 |
MafA | Forward: 5′->3′cttcagcaaggaggaggtcatc Reverse: 5′->3′gcgtagccgcggttctt | 67 |
Nkx6.1 | Forward: 5′->3′tcttctggcctggggtgatg Reverse: 5′->3′ggctgcgtgcttctttctcca | 121 |
Glut2 | Forward: 5′->3′tgggttccttccagttcg Reverse: 5′->3′aggcgtctggtgtcgtatg | 166 |
Ngn3 | Forward: 5’->3′tggcactcagcaaacagcga Reverse: 5’->3’acccagagccagacaggtct | 101 |
Beta-actin | Forward: 5′->3′tggcactcagcaaacagcga Reverse: 5′->3′acccagagccagacaggtct | 101 |
