Table 1 Human or swine TTV- specific PCR assays used for the assessment of the human and swine sera.
From: Identification of heterologous Torque Teno Viruses in humans and swine
PCR | PCR Type | Target | Forward Primer | Reverse Primer | Size (bp) | BLASTresults |
|---|---|---|---|---|---|---|
Pan-Human TTV | qPCR | Untranslated region (Conserved) | 5′gtaagtgcacttccgaatggctgag3′ | 5′gcccgaattgcccttgac3′ | 132 | a AB041007.1 |
a AF122915.1 | ||||||
b KJ082064.1 | ||||||
b AY590626.1 | ||||||
Pan-TTSuV UTR 1 | qPCR | Untranslated region (Conserved) | 5′cgaatggctgagtttatgcc3′ | 5′gataggccccttgactccg3′ | 95 | a KR054745.1 |
a , b KR131718.1 | ||||||
b HM633251.1 | ||||||
b KR054745.1 | ||||||
TTSuV1- UTR 2 | Gel-based | Untranslated region (Conserved) | 5′gcggtcaaaatggcggaag3′ | 5′ggacttgagctcccgaccaa3′ | 124 | a EU564163.1 |
a JF451574.1 | ||||||
b EU006509.1 | ||||||
b JX872390.1 | ||||||
TTSuV1-ORF2 | Gel-based | ORF2 (Variable) | 5′agtcaagcttttgccggaacactgggaggaag3′ | 5′acgtctcgagccagccatcgtcgccgat3′ | 235 | a JX535326.1 |
a HM633254.1 | ||||||
b HM633254.1 | ||||||
b JX535326.1 | ||||||
TTSuV1-ORF3 | Gel-based | ORF3 (Variable) | 5′gcgacgatggctgtttggaggtgaaataccaaccc3′ | 5′acgtctcgaggcgtttcttttgttttttat3′ | 477 | a HM633244.1 |
a HM633254.1 | ||||||
b HM633254.1 | ||||||
b JX535326.1 |
