Table 4 Clustering analysis of RNA libraries derived from company B was used to identify related sequence groups.
Group | 30-nt random sequences | B-derived initial RNA libraries | |||||
---|---|---|---|---|---|---|---|
Reads of each groups in top 50 unique sequences | Frequency of each groups in top 1000 unique sequences | Frequency of each groups in total usable reads | |||||
Solution PCR | ddPCR | Solution PCR | ddPCR | Solution PCR | ddPCR | ||
1 | TTTCGTCCTGAGTTCGTGTCCTCGTCTGTG | 100 | 155 | 3.16% | 4.79% | 0.0003% | 0.0003% |
Others | Orphan sequences | 189 | 186 | 5.96% | 5.75% | 0.0005% | 0.0004% |
Total reads of top 50 unique sequences | 289 | 341 |