Table 1 Primer sequences for genes examined in and corresponding amplicon size.

From: MiR-146b is down-regulated during the chondrogenic differentiation of human bone marrow derived skeletal stem cells and up-regulated in osteoarthritis

Gene

Primer Sequences

Amplicon size

Human ACTB

F: 5′ggcatcctcaccctgaagta 3′ R: 5′aggtgtggtgccagattttc 3′

82 bp

Human SOX9

F: 5′cccttcaacctcccacacta 3′ R: 5′ tggtggtcggtgtagtcgta 3′

74 bp

Human COL2A1

F: 5′cctggtccccctggtcttgg 3′ R: 5′ catcaaatcctccagccatc 3′

58 bp

Human ACGAN

F: 5′gacggcttccaccagtgt 3′ R: 5′gtctccatagcagccttcc 3′

90 bp

Human COL9A1

F: 5′cctggtgctcttggtttga 3′ R: 5′ cacgctcccccttttctc 3′

58 bp

Human MMP13

F: 5′ttaaggagcatggcgacttct 3′ R: 5′ cccaggaggaaaagcatgag 3′

71bp

Human SOX5

F: 5′tagctagtccttcagccagagtt 3′ R: 5′ccttcatttgccgagcttctt 3′

93 bp