This Article contains errors in the Materials and Methods section under subheading ‘Prevalence investigation of P1-like bacteriophage in Salmonella isolates’, where incorrect primers were quoted.
“The presence of the insertion sequence on the other nontypeable plasmids carrying blaCTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)”.
should read:
“The presence of the insertion sequence on the other nontypeable plasmids carrying blaCTX-M-27 gene was detected using the following primers: IR-fw-(GTTGCTGGCTGACGCCTATGAAG) and IR-rev-(ATGTTTGCCATTTCATAGGGGAG)”.
Additional information
The online version of the original article can be found at 10.1038/srep40710
Rights and permissions
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
About this article
Cite this article
Yang, L., Li, W., Jiang, GZ. et al. Correction: Corrigendum: Characterization of a P1-like bacteriophage carrying CTX-M-27 in Salmonella spp. resistant to third generation cephalosporins isolated from pork in China. Sci Rep 7, 46728 (2017). https://doi.org/10.1038/srep46728
Published:
DOI: https://doi.org/10.1038/srep46728