This Article contains typographical errors. In the Results section,
“We reprogrammed primary dermal fibroblasts isolated from a female patient with AS harboring a three-base pair deletion in exon 4 of the UBE3A gene (accession NM_130838)11, and from a normal healthy control person.”
should read:
“We reprogrammed primary dermal fibroblasts isolated from a female patient with AS harboring a three-base pair deletion in exon 5 of the UBE3A gene (accession NM_130838)11, and from a normal healthy control person.”
In Table S8 of the Supplementary Information file, the sequence of the forward primer ‘SNHG14_RT17_F’ for ‘qRT-PCR neuronal differentiation’,
“cttgagtattccggaagtaaaagc”
should read:
“ctcttcttgcagtttacaacgg”
Additional information
The online version of the original article can be found at https://doi.org/10.1038/srep30792
Rights and permissions
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
About this article
Cite this article
Stanurova, J., Neureiter, A., Hiber, M. et al. Correction: Corrigendum: Angelman syndrome-derived neurons display late onset of paternal UBE3A silencing. Sci Rep 8, 46952 (2018). https://doi.org/10.1038/srep46952
Published:
DOI: https://doi.org/10.1038/srep46952
