Table 2 Key resources table
Reagent/Resource | Source | Identifier |
|---|---|---|
Chemicals, peptides, etc | ||
Alcian 8GX certified by Biological Stain Commission | Sigma-Aldrich | Cat# A3157 |
Alizarin red S | Sigma-Aldrich | Cat# A5533 |
OCT compound | Tissue-Tek | Ref# 4583 |
Proteinase K | Qiagen | Cat# 19131 |
MyTaq Red PCR mix | Bioline | Cat# BIO-25047 |
Calcein | Sigma-Aldrich | Cat# C0875 |
Eosin-Y | Thermo scientific | Cat# 201931000 |
Hematoxylin | Sigma-Aldrich | Cat# GHS132 |
CryoJane tape-transfer system | Leica | Â |
 Tape windows | Leica | Cat# 39475214 |
 Solution A | Leica | Cat# 39475270 |
 Solution B | Leica | Cat# 39475272 |
Fluoromount-G mounting medium | Invitrogen | Cat# 00-4958-02 |
Bioworld epitope unmasking buffer | Fisher scientific | Cat# 50-199-077 |
NPR3 anti-Rabbit polyclonal antibody | Invitrogen | Cat# PA5-96947 |
Alexa Fluor 594 Goat Anti-Rabbit IgG (H&L) | Invitrogen | Cat# ab150080 |
DAPI | Invitrogen | Cat# D1306 |
Critical commercial assays | ||
Click-iTTM EdU Kit, Alexa Fluor 647 | Invitrogen | Cat# C10340 |
RNeasy Micro Kit | Qiagen | Cat# 74004 |
QIAshredder | Qiagen | Cat# 79656 |
Experimental models: Organisms/strains | ||
Mus musculus (CD-1 Strain) | Charles River Labs | Strain Code: 022 |
Mus musculus (C57BL/6 Strain) | Charles River Labs | Strain Code: 027 |
Mus musculus Npr3−/− | Olgin Lab, UCSF | MGI:2158355 |
Jaculus jaculus | UCSD Cooper Lab | Â |
Oligonucleotides | ||
NPR3 primer Forward | 3′ CACAAGGACACGGAATACTC 53′ | |
NPR3 primer Reverse | 3′ CTTGGATGTAGCGCACTATGTC 53′ | |
NPR3 primer Neo Forward | 3′ ACGCGTCACCTTAATATGCG 53′ | |
Software and algorithms | ||
FIJI97 | ||
InteredgeDistance Macro for FIJI | Santosh Patnaik | |
DataViewer | Bruker | |
DESeq245 | ||
STAR100 | ||
TOGA44 | ||
CutAdapt98 | ||
FastQC99 | ||
Trim Galore | ||
R packages used in analysis | ||
 ggplot2 | ||
 dplyr | ||
 Plotly | ||
 clusterProfiler47 | ||
 Hrbrthemes version 0.8.7 | ||
 Paletteer version 1.3.0 | ||
 BiocManager version 1.30.25 | ||
 GeneOverlap101 version 1.40.0 | ||
 gprofiler2 version 0.2.3 | ||
 Tidyr version 1.3.1 | ||
 RColorBrewer version 1.1-3 | ||
 Viridis version 0.6.5 | ||
 Reshape2 | ||
Graphpad Prism software | ||
Adobe Creative Cloud (Illustrator and Photoshop) | ||