Abstract
Glycosphingolipids (GSLs) are abundantly expressed in cancer cells. The effects of GSL-targeted immunotherapies are not fully understood. Here, we show that the inhibition of GSL synthesis with the UDP-glucose ceramide glucosyltransferase inhibitor eliglustat can increase the exposure of the major histocompatibility complex (MHC) and tumour antigen peptides, enhancing the antitumour response of CD8+ T cells in a range of tumour models. We therefore conducted a proof-of-concept phase I trial on the combination of eliglustat and an anti-PD-1 antibody for the treatment of advanced cancers (NCT04944888). The primary endpoints were safety and feasibility, and the secondary endpoint was antitumor activity. All prespecified endpoints were met. Among the 31 enrolled patients, only 1 patient experienced a grade 3 adverse event (AE), and no grade 4 AEs were observed. The objective response rate was 22.6% and the disease control rate reached 71%. Of the 8 patients with proficient mismatch repair/microsatellite stable (pMMR/MSS) colorectal cancer, one achieved complete response and two each had partial response and stable disease. In summary, inhibiting the synthesis of GSLs might represent an effective immunotherapy approach.
Similar content being viewed by others
Introduction
Glycosphingolipids (GSLs) are often abnormally expressed in cancer cells1,2,3,4,5, which undergo structural rearrangement during cellular transformation, metastasis, and multidrug resistance3,6,7,8,9,10. GSLs interfere with membrane proteins and the antitumour immune response11,12,13. For instance, GM2 and GM3 gangliosides shed from melanoma cells inhibit Fc receptor expression on monocytes and macrophages and NK cell activity14, suggesting that GSLs are a viable target for tumour treatment.
Many GSLs are tumour-associated antigens5. The top 75 cancer-associated antigens include four GSLs15, among which GD2 is consistently overexpressed in neuroblastoma, osteosarcoma, glioma, and neuroendocrine tumours and has been studied as a potential target of CAR-T cells16,17,18,19. Although anti-GD2 antibodies have increased the survival rate of neuroblastoma patients, they are effective only when they are administered in combination with intensive cytotoxic chemotherapy regimens, causing long-term side effects such as hearing loss, growth retardation, and secondary leukaemia20. GD3 monoclonal antibodies have been used to treat melanoma patients, but the results are generally underwhelming, likely due to limited antibody availability21. A preclinical trial investigated the efficacy of the antibody BMS-986012, which targets Fucosyl-GM1, in treating small-cell lung carcinoma22. Nevertheless, the number of GSL-targeting agents and their efficacy are still limited. Additionally, the impact of anticancer immunotherapies on multiple GSLs remains unknown.
Aberrations in GSL metabolism are usually caused by changes in the expression of enzymes producing different GSL classes23,24, including A4GALT (globo-series), A3GALT2 (isoglobo-series), B3GNT5 (lacto-series and nsGSLs), B4GALNT1 (gangliosides, o-series), and ST3GAL5 (gangliosides, a, b, and c series)25,26,27. Additionally, Golgi-resident intramembrane protease signal peptide peptidase-like 3 (SPPL3) is an upstream B3GNT5 shear enzyme that impedes the synthesis of nsGSLs, increasing the binding of HLA-I to receptors28. Our prior research has shown that the loss of SPPL3 inhibits CAR-T-cell antitumour cytotoxicity29, suggesting that GSLs may protect cells presenting certain antigens from immune cell killing. Compared with normal tumours, multidrug-resistant tumours may synthesize GSLs faster30,31. Glucosylceramide (GlcCer), synthesized by uridine diphosphate-glucose ceramide glycosyltransferase (UGCG), is the precursor of all GSLs26. In 2014, the UGCG inhibitor eliglustat received FDA approval for Gaucher disease treatment32. Eliglustat alters ceramide metabolism, causing decreased glycosphingolipid synthesis and efflux of Cav-1 sphingolipid particles containing mitochondrial proteins and lipids and suppressing tumour growth33. Therefore, eliglustat may restore tumour sensitivity to anticancer drugs by inhibiting GSL synthesis. Apart from drug resistance, the high expression of GSLs in tumours also negatively affects T-cell and dendritic cell (DC) function34,35,36. Therefore, understanding the role of GSLs in tumour immunosuppression and the related mechanisms is crucial for tumour immunotherapy.
In this work, we show that the UGCG inhibitor eliglustat inhibits the expression of GSLs on the surface of tumour cells and increases the accessibility of the p-MHC epitope for T-cell recognition and binding, significantly enhancing the antitumour effect of CD8+ T cells. Mechanistically, we demonstrate that eliglustat mediates the migration of CD8+ T cells from lymph nodes to tumours and increases the number of antitumour-specific CD8+ T cells and the diversity of T-cell receptors. Finally, the results of proof-of-concept clinical trials shows that the combination of eliglustat with immune checkpoint blockade can exhibit a favourable safety profile and improve cancer treatment efficacy.
Results
GSL inhibition does not affect cancer cell proliferation
First, a lipidomic analysis was performed to determine the effect of the commercially available UGCG inhibitor eliglustat on lipid metabolism and expression. Among the 1711 cellular lipid species identified, 240 were increased and 133 were decreased by eliglustat treatment (Supplementary Fig. S1A). Functional enrichment analysis revealed that these significant changes (positive z score) were related to lipid metabolism (Supplementary Fig. S1B), including 11 species involved in GSL metabolism (e.g. TG, SMM, FA, DG, DGDG, DGMG, Hex2Cer, GM3, Hex3Cer, Hex1Cer, and CerG3GNAc1), which were markedly decreased (Supplementary Fig. S1C). The most pronounced treatment-related changes occurred for hexosylceramides and GM3, followed by sphingomyelins. The above results confirm that eliglustat at 400 nM can inhibit the synthesis of GSLs.
Next, to determine whether the concentration of eliglustat that effectively inhibited GSL synthesis had a direct toxic effect on tumour cells, we tested the effect of different eliglustat concentrations on cell viability and found that the IC10 was 8.5 μM in MC38-OVA cells and 6.4 μM in B16f10-OVA cells after treatment with eliglustat for 24 h; both of these concentrations were much greater than the concentration required to inhibit GSL synthesis (Supplementary Fig. S2A and S2B). The flow cytometry results showed that eliglustat had no effect on apoptosis, the number of tumour cells or Ki67 expression at concentrations less than or equal to 400 nM (Supplementary Fig. S2C–G). Similarly, long-term colony formation assays of MC38-OVA and B16f10-OVA tumour cells revealed no significant difference between the 400 nM eliglustat group and the control group (Supplementary Fig. S2H, S2I). Furthermore, an MC38-OVA subcutaneous graft tumour model was established in NTG mice or BALB/c nude mice, and no remarkable antitumour effect was observed with eliglustat in the dose range of 5–100 mg/kg (Supplementary Fig. S3). The above results indicate that eliglustat has no significant toxic effect on tumour cells within the concentration range required to inhibit GSL synthesis.
In vivo tumour growth is attenuated by eliglustat
We next investigated whether eliglustat could induce in vivo antitumour immune responses in a series of tumour models established with immunocompetent mice. Using MC38-OVA tumour-bearing mice, we found that 10, 30, 60, and 100 mg/kg eliglustat administered by gastric gavage markedly attenuated tumour growth. Notably, the antitumour effect was not dose-dependent since the 10 mg/kg and 100 mg/kg eliglustat groups showed the same degree of tumour growth inhibition (Fig. 1a, b). Moreover, even in a poorly immunogenic and highly aggressive tumour model established by B16f10-OVA transfection37, the antitumour effect of eliglustat was similar to that in the MC38-OVA tumour model (Supplementary Fig. S4A). To further observe the long-term antitumour effect and acute toxicity of eliglustat, we observed the survival and weight of the mice during and after treatment with 10 mg/kg eliglustat and found that the treatment significantly improved their survival (Fig. 1c; Supplementary Fig. S4B); however, there was no marked difference in weight between the groups (Fig. 1d; Supplementary Fig. S4C), suggesting the low toxicity of 10 mg/kg eliglustat. Subsequently, additional tumour models, including 4T1, CT26, A20 and EG-7, were established to further validate the widespread applicability of eliglustat. The results showed that 10 mg/kg eliglustat inhibited tumour growth in mice with 4T1 (breast cancer cells with low immunogenicity) and CT26 (colorectal cancer with low immunogenicity) tumours (Supplementary Fig. S5A, S5B)37,38,39; however, it failed to inhibit tumour growth in both the A20 (B-cell lymphoma) and EG-7 (T-cell lymphoma) tumour models (Supplementary Fig. S5C, S5D). The above results suggest that eliglustat works through the immune system to exert its effects instead of directly exerting an antitumour effect in immunocompetent mice.
a Experimental design. A total of 1 × 105 tumour cells were subcutaneously injected and observed for tumour formation in C57BL/6 mice treated with different doses of eliglustat. b C57BL/6 mice were implanted with 1 × 105 MC38-OVA tumour cells, and the treatment scheme is shown in (a). Tumour sizes were measured every 3 days. The average and individual tumour curves (n = 10 per group) are shown. c Survival curves of MC38-OVA tumour-bearing mice in the control and 10 mg/kg eliglustat-treated groups (n = 10 per group). d Body weights of MC38-OVA tumour-bearing mice in the control and 10 mg/kg eliglustat-treated groups (n = 10 per group). e Injection schedule for antibody-mediated depletion of CD4+ and CD8+ T cells and NK cells and eliglustat treatment in MC38-OVA tumour-bearing mice. f C57BL/6 mice were implanted with 1 × 105 MC38-OVA cells, as shown in (e). Tumour sizes were measured every 3 days. The average and individual tumour curves (n = 7 per group) are shown. The data are shown as the mean ± SEM. ns, not significant. P values were calculated by unpaired two-sided t test in (d). P values were calculated by two-way repeated measures analysis of variance (ANOVA) in (b) and (f) and the log-rank test in (c). CON control, ELI eliglustst. Source data and exact p values are provided as a Source Data file.
Next, we used a well-established antibody-based approach to deplete CD4+ T cells, CD8+ T cells or natural killer (NK) cells to assess their roles in regulating the antitumour effect of eliglustat (Fig. 1e) and found that the depletion of CD4+ T cells or NK cells had only marginal effects. Notably, CD8+ T-cell depletion abrogated the inhibitory effects of eliglustat on tumour growth (Fig. 1f), indicating that CD8+ T cells play a major role in mediating the antitumour effect of eliglustat.
Eliglustat enhances TCR accessibility and augments T-cell function
To clarify whether eliglustat enhances the antitumour effect of T cells through tumour sensitization or immune enhancement, we pretreated tumour cells or T cells with eliglustat in vitro and then tested its killing effect and functional activity. CD8+ T-cell-mediated lysis of tumour cells was markedly increased in the eliglustat group at effector-to-target ratios of 1:1 and 1:2 (Fig. 2a). Similar results were observed in B16f10-OVA cells and human OVCAR3 tumour cells (Fig. 2b, c), and MC38-OVA cells pretreated with eliglustat showed increased sensitivity to OT-II CD4+ T cells (Supplementary Fig. S6A). Moreover, treatment of tumour cells with eliglustat upregulated the expression of CD107a and cytokines such as TNF-α and IFN-γ (Fig. 2d, e). However, when CD8+ T cells treated with eliglustat were cocultured with tumour cells, the CD107a level and T-cell function decreased (Fig. 2d; Supplementary Fig. S6B), suggesting that high eliglustat concentrations may affect the function or proliferation of CD8+ T cells, potentially explaining why the in vivo antitumour effects of eliglustat are not dose-dependent (Fig. 1b; Supplementary Fig. S4A). However, adding 100 or 200 nM eliglustat to the coculture system enhanced the sensitivity of tumour cells to T cells (Supplementary Fig. S6C) without affecting the apoptosis or proliferation of T cells (Supplementary Fig. S6D–S6G). These data indicate that eliglustat mainly enhances the antitumour effect of T cells by regulating tumour cells, but the underlying mechanisms are unclear. Previous studies have shown that GSLs can mask and block the interactions of membrane proteins28,40,41. We hypothesized that inhibiting GSL synthesis may increase tumour surface antigen exposure, enhance immune cell accessibility, and initiate antigen-mediated tumour-specific immune responses. Indeed, eliglustat enhanced the binding of H2-Kb MHC I molecules to SIINFEKL (Fig. 2f; Supplementary Fig. S7), and more tumour cells bound to OT-1 CD8+ T cells upon exposure to eliglustat (Fig. 2g). To further investigate eliglustat-dependent antibody accessibility to MHC-I, we performed additional titrations using MHC-I-specific antibodies recognizing distinct MHC-I epitopes and β2m epitopes. The binding of antibodies to H-2Kb MHC class I (clones AF6-88.5) and SIINFEKL-H-2Kb (clones 25-D1.16) was markedly affected by eliglustat. The binding of antibodies to β2m (clones A16041A) was not affected by eliglustat. These results indicate that the accessibility of the MHC-I epitope recognized by H-2Kb was hindered (Supplementary Fig. S8). To rule out the possibility of off-target effects of eliglustat, tumour cells were pretreated with another clinically approved GSL synthesis inhibitor, miglustat, and then cocultured with OT-I CD8+ T cells, which showed similar effects on the lysis of tumour cells, the expression of TNF-α and IFN-γ, the binding of SIINFEKL to H2-Kb MHC I molecules and the interaction between tumour cells and OT-1 CD8+ T cells (Supplementary Fig. S9). An in vivo model also showed that tumour formation in the mice injected with eliglustat-treated MC38-OVA and B16f10-OVA cells was decreased, and the overall survival rate of the eliglustat-treated groups was increased (Fig. 2h–j; Supplementary Fig. S10A–S10C). Eliglustat induced an overall increase in the number of both CD8+ and CD4+ T cells, the expression levels of IFN-γ and TNF-α in both CD8+ and CD4+ T cells, and the number of antigen-specific CD8+ T cells (Tetramer-SIINFEKL+CD8+T) (Supplementary Fig. S10D). These results confirm that inhibiting GSL synthesis can enhance the exposure of tumour surface antigens, increase the accessibility of immune cells, initiate antigen receptor-mediated tumour-specific immune responses, promote tumour-specific CD8+ and CD4+ T-cell activation and expansion, and ultimately enhance the tumour-killing ability of T cells in vivo.
a CD8+ T-cell killing assay of MC38-OVA-GFP cells cocultured at different ratios with CD8+ T cells isolated from OT-I mice that had been pretreated with anti-CD3, anti-CD28 antibodies and IL-2. MC38-OVA-GFP cells were pretreated with eliglustat. The number of viable MC38-OVA-GFP cancer cells at the end of the assay was determined and reported (n = 3). b, CD8+ T-cell killing assay of B16f10-OVA-GFP cells cocultured at different ratios with CD8+ T cells isolated from OT-I mice. B16f10-OVA-GFP cells were pretreated with eliglustat. The number of viable B16f10-OVA-GFP cancer cells at the end of the assay was determined and reported (n = 3). c NY-ESO-1-TCR+ T-cell killing assay of CD8+ T cells isolated from healthy volunteers cocultured at different ratios with OVCAR3-GFP cells pretreated with eliglustat. The number of viable OVCAR3-GFP cancer cells at the end of the assay was determined and reported (n = 3). d, e FACS analysis of IFN-γ-, TNF-α-, and CD107a-positive CD8+ T cells after coculture with MC38-OVA cancer cells at an effector-to-target ratio of 1:1 (n = 3). Bar colours (d): T cells (red), T cells treated with eliglustat (cyan), T cells + OVA-MC38 (dark green), T cells (eliglustat) + OVA-MC38 (orange), T cells + OVA-MC38(eliglustat) (purple). f MHC-I, MHC-II and H-2Kb-SIINFEKL of MC38-OVA were measured by flow cytometry (n = 3). Bar colours (e, f): control (red), 400 nM eliglustat (dark green). g OT-I T cells were stained with AF700-conjugated anti-CD8 and incubated with MC38-OVA (CFSE) cells at an E:T ratio of 2:1. Flow cytometry analysis of the proportion of OT-I T cells conjugated to MC38-OVA (CFSE) cells (n = 3). h Experimental design. MC38-OVA cells were pretreated with eliglustat for 7 days in vitro, and 0.5 × 105 tumour cells were injected subcutaneously. Tumour formation was observed in C57BL/6 mice. i The tumour curves of the MC38-OVA tumour-bearing mice are shown, and the treatment scheme is shown in (h). j The survival curves of MC38-OVA tumour-bearing mice are shown, and the treatment scheme is shown in (h) (n = 10 per group). The data represent three independent experiments with similar results (a–g). The data are presented as the means ± SEMs. ns, not significant. P values in (d–f) were calculated by unpaired two-sided t tests. P values in (a), (b), (c), (g) and (i) were determined by two-way repeated measures ANOVA and the log-rank test in (j). CON control, ELI eliglustst. Source data and exact p values are provided as a Source Data file.
UGCG deficiency augments T-cell function
Subsequently, to clarify whether the deficiency of UGCG, the key enzyme in GSL synthesis, can also promote the anti-tumour response of T cells, we knocked out UGCG in MC38-OVA cells using CRISPR/Cas9 technology and detected the effects of UGCG deficiency on tumour cell proliferation, clone formation, MHC molecule accessibility, and T cell anti-tumour ability in vitro and in vivo. The results showed that UGCG deficiency did not affect the proliferation and clone formation of MC38-OVA cells (Fig. 3a–c), but could lead to increased accessibility of H2-Kb and its antibodies (Fig. 3d), enhanced sensitivity to T cell killing (Fig. 3e), and increased expression levels of cytokines such as IFN-γ and TNF-α in T cells (Fig.3f). By monitoring the growth of tumours inoculated into mice, it can be seen that UGCG deficiency can significantly inhibit tumour growth (Fig. 3g), and the inhibitory effect of this tumour growth seems to be more robust than pharmacological intervention in GSL synthesis. The number of CD8+T cells infiltrating tumours significantly increased both in percentage and absolute quantity. In addition, the number of IFN-γ and TNF-α positive cells, as well as Tetramer-SIINFEKL+CD8+T, were also significantly increased (Fig. 3h). The above results further confirm that blocking GSL synthesis can enhance the response of T cells to tumour cells.
a Western blot analysis of the expression of UGCG in MC38-OVA with and without UGCG knockout. GAPDH was used as a protein loading control. The analysis was done thrice with biologically independent samples. b Cell proliferation of sgCONT or sgUGCG-MC38-OVA tumour cells by FACS analysis (n = 3). c Colony formation ability of MC38-OVA tumour cells with sgCONT or sgUGCG tumour cells on day 14 (n = 3). d Titration curves of MHC-I-specific antibodies on MC38-OVA cells. Flow cytometry charts of antibody stain as indicated by the arrow. MFI, mean fluorescence intensity (n = 3). e CD8+ T-cell killing assay of sgUGCG-MC38-OVA tumour cells cocultured in different ratios with CD8+ T cells isolated from OT-I mice. The number of viable sgUGCG-MC38-OVA tumour cells at the end point of the assay was determined and reported (n = 3). f FACS analysis IFN-γ, TNF-α, expression of CD8+ T cells after coculture with sgUGCG-MC38-OVA tumour cells at an effector-to-target ratio of 1:1 (n = 3). g, sgCONT- and sgUGCG-MC38-OVA cells grown in C57BL/6 mice(n = 10). About 2 × 105 sgCONT- and sgUGCG-MC38-OVA cells were inoculated subcutaneously into syngeneic mice and monitored for tumour formation. h Phenotype and function of TILs from sgCONT- and sgUGCG-MC38-OVA tumours were detected by flow cytometry analysis at day 21 after tumour inoculation (n = 3). Surface levels of CD8+ T cells, IFN-γ, TNF-α and Tetramer on tumour-infiltrating CD8+ T cells of different groups were analysed. Bar colours (f, h): control sgRNA (red), sgRNA targeting UGCG (dark green). The data represent three independent experiments with similar results (b–f). Data are shown as the mean ± SEM. ns, not significant. P values in (b, c, f and h) were calculated by unpaired two-sided t test. P values in (e) were calculated by unpaired two-sided t tests. P values in (g) were determined by two-way repeated measures ANOVA. Source data and exact p values are provided as a Source Data file.
GSL blockade alters the tumour immune cell composition
Next, to determine whether eliglustat also has an impact on immune cells other than T cells, we performed cytometry by time-of-flight (CyTOF) on CD45+ tumour-infiltrating immune cells and found that the proportions of CD4+ T cells, CD8+ T cells, NK cells and M1-type tumour-associated macrophages (TAMs) increased, and the proportions of tumour-infiltrating M2-type TAMs and myeloid-derived suppressor cells (MDSCs) substantially decreased in the eliglustat group, while the percentages of γδT cells and DCs remained unaltered despite the upregulation of the expression of CD11c and CD103 (Fig. 4a, b, Supplementary Fig. S11 and S12). The flow cytometry results showed an increasing trend in CD103-positive DC subsets (Supplementary Fig. S13). The numbers of CD8+ T cells, CD4+ T cells, and CD103+ cells were increased in the infiltrated tumour regions of the eliglustat treatment group (Supplementary Fig. S14). To explore whether T cells changed in areas other than the tumour tissue, we analysed the number and function of T cells from the tumour tissue, peripheral blood (PB) and spleen of MC38-OVA tumour-bearing mice and found that compared to 0 mg/kg, 5, 10, 30, 60, and 100 mg/kg eliglustat induced an overall increase in both CD8+ and CD4+ T-cell infiltration, the expression levels of IFN-γ and TNF-α, and the number of antigen-specific CD8+ T cells (Tetramer-SIINFEKL+CD8+T) (Supplementary Fig. S15A, S15B). The T-cell exhaustion marker PD-1 was upregulated, while TIM-3 showed no significant changes (Supplementary Fig. S15C). However, the number of both CD8+ and CD4+ T cells in the PB gradually decreased, while in the spleen, there were no significant changes (Supplementary Fig. S15D, S15E). These results demonstrated that eliglustat increased the number of T cells, mainly within the tumour.
a MC38-OVA tumour samples were collected from tumour-bearing mice on Day 21 with or without eliglustat and subjected to a CyTOF assay. The t-SNE plot shows all CD45+ cells, coloured according to the type of immunocyte (n = 3). b Proportions of CD4+ and CD8+ T cells in CD45+ T-cell clusters (n = 3). c,d Total TCRs, clonal type, unique TCRs (D50), and average CDR3 length of T cells from both the control and eliglustat-treated tumours and spleens were determined by using TCR-β CDR3 sequencing (n = 9). Box plots display the median (centre line) and minimum and maximum values (boxes) (b–d). Box colours (b–d): control (red), eliglustat treated (blue). e,f MC38 tumour-bearing mice 21 days after eliglustat treatment. CD8+ T cells were collected from dLNs and tumours, and the IFN-γ ELISPOT assay was performed with 4T1 or MC38 cell restimulation (n = 4). The data represent three independent experiments with similar results (b–f). Box plot whiskers extend to the minimum and maximum values, with the centre line indicating the median, and the box encompassing the interquartile range. P values were determined by unpaired two-sided t tests in (b, c, d and f). CON control, ELI eliglustst, dLN draining lymph node. Source data and exact p values are provided as a Source Data file.
To determine whether T-cell expansion involves the exposure of other antigens in addition to the OVA antigen, we performed molecular analysis of the T-cell antigen receptor (TCR) repertoire and found that the total TCR counts and the number of unique TCRs were dramatically increased by eliglustat in tumours (Fig. 4c) but were not markedly affected in the spleen (Fig. 4d). To assess their responses to tumour antigens, an IFN-γ ELISPOT assay was performed with irradiated MC38 cells, and many more T-cell immunospots were isolated from the draining lymph nodes (dLNs) and from the tumours of the eliglustat group (Fig. 4e, f). These data indicate that eliglustat contributes to the presentation of an array of antigen epitopes, shaping the breadth of tumour antigen-specific CD8+ T-cell antitumour responses.
Tumour-specific T cells are mainly primed in dLNs after eliglustat therapy
To investigate whether T cells inside tumours or dLNs are more essential for eliglustat treatment, we used FTY720 to block sphingosine 1–phosphate receptor 1, thereby prohibiting T cells from exiting the lymphoid organs. When mice with MC38-OVA-bearing tumours were treated with FTY720 on Day 4 and eliglustat on Day 5 (Fig. 5a), the therapeutic effect of eliglustat was almost abolished (Fig. 5b), the number of CD8+ T cells in the PB and tumours decreased markedly (Fig. 5c), and the eliglustat-mediated increase in the number of OVA-specific CD8+ T cells was completely eliminated (Fig. 5d), suggesting that the reactivation of T cells within the tumour was insufficient and that T cells in dLNs are essential for the therapeutic effect of eliglustat. In addition, mice deficient in CD103+ DCs (Batf3−/−)42, which play pivotal roles in CD8+ T-cell priming and recruitment into tumours, showed an almost complete loss of tumour-infiltrating CD8+ T cells after treatment (Supplementary Fig. 16a). Similarly, the administration of eliglustat to Batf3−/− mice did not effectively control tumour growth (Supplementary Fig. 16b). Intriguingly, when eliglustat was administered to MC38-OVA model mice on Day 0 and FTY720 was administered on Day 7 (Fig. 5e), FTY720 had no impact on the therapeutic effect of eliglustat (Fig. 5f). Although the total number of CD8+ T cells in the PB and tumours decreased after FTY720 treatment, the OVA-specific CD8+ T cells in the tumours were less damaged and did not change significantly in number (Fig. 5g, h). Taken together, tumour-specific T cells are largely primed in dLNs after treatment, and the recirculation of those primed T cells to the tumour tissues promotes tumour control.
a Experimental design. MC38-OVA-bearing mice were administered FTY720 on Day 4 and 10 mg/kg eliglustat on Day 5, starting on Day 21 through the end of the experiment (n = 5). b Tumour curves of MC38-OVA tumour-bearing mice; the treatment scheme is shown in Fig. 4a. c Flow cytometric analysis of T cells from dLNs, peripheral blood, and tumours. The percentages of CD8+ T cells in the dLNs, peripheral blood, and tumours of different groups of mice (n = 3). d Absolute numbers of CD8+ T cells and CD8+ tetramer+ T cells in different groups of mice (n = 3). e Experimental design. MC38-OVA-bearing mice were administered 10 mg/kg eliglustat on Day 0 and were administered FTY720 on Day 7, starting on Day 21 through the end of the experiment (n = 5). f Tumour curves of MC38-OVA tumour-bearing mice(n = 7); the treatment scheme is shown in Fig. 4e. g Flow cytometric analysis of T cells from dLNs, peripheral blood, and tumours. The percentages of CD8+ T cells in the dLNs, peripheral blood, and tumours of different groups of mice (n = 3). h Absolute numbers of CD8+ T cells and CD8+ tetramer+ T cells in different groups of mice (n = 3). The data represent three independent experiments with similar results. The data are presented as the means ± SEMs. ns, not significant. P values were determined by two-way repeated measures ANOVA in (b and f) and by unpaired two-sided t tests in (c, d, g and h). CON control, ELI eliglustst, dLN draining lymph node, PB peripheral blood. Source data and exact p values are provided as a Source Data file.
Eliglustat synergizes with ICB to promote tumour suppression
Eliglustat promoted T-cell infiltration into tumours (Supplementary Fig. S14A–D), accompanied by an increase in PD-1 expression on tumour-infiltrating CD8+ T cells (Supplementary Fig. S15C), suggesting that eliglustat can synergize with an anti-PD1 antibody to exert antitumour effects. We treated syngeneic MC38-OVA tumour-bearing C57BL/6 mice with the combination of eliglustat and an anti-PD1 antibody (Fig. 6a) and found that the combination therapy had a stronger tumour suppressive effect than either monotherapy (Fig. 6b). Compared with the monotherapies, the combination treatment markedly increased the proportion of intratumoural CD8+ T cells, the expression levels of IFN-γ and TNF-α and the proportion of tetramer+ CD8+ T cells. Moreover, PD-1 expression in CD8+ T cells tended to decrease in the combination group and the PD-1 monotherapy group (Fig. 6c). These results highlight the potential of eliglustat combined with an anti-PD1 antibody as a prospective cancer immunotherapy strategy.
a Experimental design. C57BL/6 mice were transplanted with 1 × 105 MC38-OVA cells and treated with PBS (CON group), eliglustat alone (ELI, 10 mg/kg), an anti-PD-1 antibody alone (a-PD-1, 200 mg/kg per mouse) or eliglustat plus anti-PD-1 as indicated (ELI+ a-PD-1). Tumour sizes were examined every other day. b Average and individual tumour growth curves of each treatment group are shown (n = 7). c The phenotype and function of tumour-infiltrating lymphocytes from MC38-OVA tumours were determined by flow cytometry analysis on Day 21 after tumour inoculation (n = 3). CD4+ T cells, CD8+ T cells, IFN-γ, TNF-α, PD-1, TIM-3 and tetramer+ cell surface levels in the tumours of different treatment groups. Absolute numbers of CD4+ T cells, CD8+ T cells and IFN-γ+, TNF-α+, and tetramer+ T cells per 106 cells (n = 3). Bar colours (d): control (red), eliglustat (cyan), ant-PD-1 (dark green), eliglustat + anti-PD-1 (orange). The data represent three independent experiments with similar results. The data are presented as the means ± SEMs. ns, not significant. P values were determined by two-way repeated measures ANOVA in (b) and unpaired two-sided t tests in (c). CON control, ELI eliglustst. Source data and exact p values are provided as a Source Data file.
The antitumour activity of the combination treatment was further confirmed in B16f10-OVA, 4T1, CT26, A20, and EG-7 tumour models (Supplementary Fig. S17) as well as in high-burden tumour models (Supplementary Fig. S18), suggesting that this treatment strategy is applicable to different types of tumours. Moreover, the effect of eliglustat combined with a CTLA-4 inhibitor was similar to that of a PD-1 inhibitor (Supplementary Fig. S19). We also evaluated miglustat combined with a PD-1 inhibitor and found that compared with monotherapy, the combination treatment dramatically suppressed tumour growth (Supplementary Fig. S20). Overall, these data suggest that eliglustat can enhance the efficacy of ICB by regulating the synthesis of GSLs in tumour cells.
Clinical responses to eliglustat in combination with PD1 antibodies in patients with advanced tumours
Based on our preclinical findings, we subsequently conducted an open-label, proof-of-concept, phase I clinical trial in individuals with advanced and incurable malignancies (NCT04944888). Between 1 October 2021 and 31 March 2023, 53 patients were initially recruited. Sixteen violated the inclusion/exclusion criteria and 6 withdrew their informed consent before treatment, leaving 31 patients for the final analysis and safety study (Fig. 7). The characteristics of the patients are shown in Table 1 and Supplementary Table 1 and Supplementary Table 2. All 31 patients who had advanced progressive tumours had failed to respond to multiple therapies. Twenty-three patients had received systemic anti-PD-1/PD-L1 therapy prior to enrolment and did not achieve disease remission, and the remaining eight patients with pMMR/MSS colorectal cancer were considered hypo-responsive to PD-1 antibodies43. A comprehensive summary of the eligibility criteria can be found in the ‘Methods’ section.
Of the 53 patients recruited, 16 violated the inclusion/exclusion criteria, and 6 withdrew their informed consent, resulting in the final enrolment of 31 patients. The dose of eliglustat used in the early part of the trial was 84 mg, and after no dose-related toxicity was observed clinically, the remaining 13 patients were given a dose of 168 mg. Eliglustat was administered once daily for the first 14 days and then every other week until the 24th week. For participants who continued to benefit from the trial, eliglustat was administered daily every other week up to 96 weeks. Immune checkpoint inhibitors were administered intravenously on Day 5 or Day 15 every 3 weeks. For subjects whose greatest lesion diameter was ≥3 cm, immune checkpoint inhibitors were administered on Day 5. For subjects whose greatest lesion diameter was <3 cm, immune checkpoint inhibitors were administered on Day 15. ELI eliglustat.
The primary objective was to assess the safety and feasibility of the combination treatment, in which eliglustat was used in the dose range approved for the treatment of Gaucher disease. We initially used a conservative daily dose of 84 mg of eliglustat, taking into account the possibility that the combination could trigger a cytokine storm in patients. After treating 18 patients, no grade 3 or higher toxicity or cytokine storm was observed, so we then increased the oral dose of eliglustat to 168 mg in the remaining 13 patients. During the trial, patients reported mild adverse events (AEs) that were well tolerated. Treatment-emergent AEs of any grade were observed in 28 patients (90.3%, 95% CI, 74.3–98.0%), among which the most common AEs were nausea (22.58%), decreased lymphocyte count (22.58%) and diarrhoea (19.35%). As shown in Table 2 and Supplementary Table 3, only one patient (3.2%, 95% CI, 0–16.7%) experienced a grade 3 AE of dermatolysis, and no grade 4 AEs were observed. Patients exhibited suitable tolerance of grade 1–2 AEs and received supportive care for grade 3 AEs. In that patient who experienced a grade 3 AE (dermoclysis), anti-PD-1 and eliglustat cotreatment was suspended, and the patient was given 1 mg/kg methylprednisolone for the first three days, which was changed to 1 mg/kg oral prednisone acetate after significant improvement in symptoms, and the dose was reduced by 5–10 mg per week. After 2 months, the skin was almost back to normal (Supplementary Fig. S21).
The secondary endpoint was efficacy. The data cut-off date for the efficacy evaluation was September 2023. The objective response rate was 22.6% (95% CI, 9.6–41.1%). The disease control rate (DCR) was 71.0% (95% CI, 52.0–85.8%), three patients achieved a complete response (CR), four achieved a partial response (PR), and fifteen patients had stable disease (SD) (Fig. 8a, b; Supplementary Fig. S22). Target tumour shrinkage per Response Evaluation Criteria in Solid Tumours (RECIST) version 1.1 and the Revised Response Criteria for Malignant Lymphoma (the 2014 Lugano classification) was seen in ten patients with postbaseline tumour assessments (Fig. 8c). Remarkably, of the 8 patients with pathologically confirmed pMMR/MSS colorectal cancer, 62.5% achieved significant clinical responses, with one achieving CR and two achieving PR and SD. In addition, for 4 patients with breast cancer, 1 CR, 1 PR and 2 SDs were obtained. All enrolled patients with hepatocellular carcinoma had SD with no objective response observed (Fig. 8a–c). Until the data cut-off date, the four patients with an objective response maintained ongoing responses, with the longest duration exceeding 21 months (Fig. 8b).
a Disease control rate in all 31 patients and patients with different cancers. b Duration following initial treatment (n = 31). Patient 36 halted treatment due to severe skin breakdown but resumed treatment after hormonal therapy. Patient 43 died from a lung infection caused by coronavirus disease after three months of SD. Patient 49 was excluded due to receiving other tumour treatments. Nine patients developed new lesions, but the primary lesion was under control. Four patients maintained ongoing responses. c Waterfall plot showing maximum changes from baseline in target lesion size in tumours of patients with different tumour types (n = 31). d Total TCRs and unique TCRs of T cells from the PB of patients who achieved an objective response according to TCR-β CDR3 sequencing (n = 7). Red represents detection at pre-treatment and dark green represents detection at post-treatment. e–j Changes in blood serum cytokine levels in patients after different cycles of anti-PD-1 antibody treatment compared to baseline (n = 31). Dotted lines represent individual patients; the solid line represents the mean of all patients. CR complete response, PR partial response, SD stable disease, PD disease progression. Source data and exact p values are provided as a Source Data file.
Predefined exploratory endpoints comprised the evaluation of dynamic changes of immune cells in PB and predictive biomarkers for efficacy and toxicity. By monitoring T cells in the PB of patients, we found a decreasing trend in the T-cell proportion, while the CD8+ T-cell proportion exhibited an increasing trend. CD25 and granzyme B expression was upregulated after one cycle of treatment (Supplementary Fig. S23). Consistent with the changes in CD25, the ratio of effector T cells to effector memory T cells tended to increase (Supplementary Fig. S24), indicating that T cells differentiated into effector cells after the combination treatment. Furthermore, we found that the total TCR counts and the number of unique TCRs were dramatically increased in the PB of patients who achieved an objective response by TCRβ repertoire analysis (Fig. 8D). Patients treated with 2–4 or more cycles of PD-1 antibody in combination with eliglustat showed an upwards trend in the levels of cytokines, such as IL-2, IL-6, IL-8 and CRP (Fig. 8e-j). Compared with those at baseline, the serum levels of carcinoembryonic antigens, such as CEA, CA15-3, CA19-9 and CA125, decreased significantly in five patients (Supplementary Fig. S25). Overall, patients who received eliglustat combined with an anti-PD1 antibody showed an increase in T-cell activation and antitumour cytokine secretion, indicating the potential for an enhanced immune response in vivo.
Discussion
Aberrant GSL expression is associated with tumour growth, metastasis, and immunosuppression; however, the therapeutic potential of pharmacologically inhibiting the synthesis of GSL in cancer cells remains unexplored. Eliglustat is an FDA-approved inhibitor of GlcCer synthase for the treatment of Gaucher disease32, and GlcCer is the precursor to a complex array of GSLs26. Here, we investigated the effects of eliglustat on antitumour immunity and found that eliglustat can inhibit the expression of GSLs on the tumour cell surface, increase the accessibility of the p-MHC epitope for T-cell receptor recognition and binding, significantly increase the antitumour effect of CD8+ T cells, effectively inhibit tumour growth and prolong the survival time of tumour-bearing mice. We also demonstrated that eliglustat mediates CD8+ T-cell migration from dLNs to tumours and increases the number and diversity of TCRs on tumour CD8+ T cells, which are essential for its therapeutic effects. Treatment with eliglustat combined with ICB can induce a robust CD8+ T-cell response and increase the pool of antitumour-specific cells and the function of CD8+ T cells by inhibiting GSL synthesis in different tumour models.
Abnormal GSL expression may represent an evolutionarily conserved and universal immune escape pathway. Pathogens such as cytomegalovirus, respiratory syncytial virus, and HIV can alter the GSL composition of host cells, potentially inducing immune evasion through HLA-I shielding44,45. In our study, we utilized eliglustat to inhibit the synthesis of GSL in tumour cells to increase the accessibility of the p-MHC epitope for TCR recognition and binding, which significantly increased the antitumour effect of CD8+ T cells. Previous studies have shown that eliglustat results in dose-dependent cytotoxicity in prostate cancer cells via mitophagy rather than through apoptotic mechanisms33. Our results showed that long-term treatment with 400 nM eliglustat had no effect on the apoptosis or proliferation of tumour cells but indicated that pretreatment of cancer cells with eliglustat enhanced the antitumour effect of CD8+ T cells, while pretreatment of T cells had an inhibitory effect on antitumour activity, which is consistent with previous research showing that treating human PB lymphocytes with PDMP, an inhibitor of UGCG, attenuated TCR signalling and T-cell activation, as indicated by a reduction in the expression of T-cell activation markers and IFN-γ secretion. Nevertheless, the addition of eliglustat to coculture systems or systemic administration has been shown to have antitumour effects both in vitro and in vivo.
Although immune checkpoint inhibitors have demonstrated promising efficacy in clinical trials for treating tumours such as melanoma46,47,48 and NSCLC49,50, response rates remain low for most tumour types. Moreover, PD-1 inhibitor immunotherapy has exhibited efficacy against a particular mismatch repair deficiency (dMMR) and microsatellite instability high subset of CRC but is seemingly ineffective against mismatch repair proficient (pMMR) and microsatellite stability (MSS) subsets51. This inefficiency is due to a low mutation load in pMMR/MSS tumours, resulting in low neoantigen expression on the major histocompatibility complex (MHC)-I molecule, which reduces the recruitment of cytotoxic CD8+ T cells to participate in the subsequent immune response. Moreover, additional factors, such as GSLs, may mask the already limited amount of tumour antigens, preventing T cells from recognizing them. A lack of intratumoural T-cell infiltration leads to immune denervation. Here, we demonstrated that eliglustat can effectively increase the exposure of tumour antigens, which enhances T-cell recognition and antitumour responses. A proof-of-concept clinical trial was conducted in patients with advanced tumours and demonstrated that eliglustat combined with a PD-1 antibody exhibited a favourable safety profile. Among all 31 enrolled patients, only 1 patient experienced grade 3 AEs, which proved to be manageable. Among the patients with pMMR/MSS colorectal cancer, only grade 1 and 2 treatment-related AEs were observed. The most frequently reported adverse event was pyrexia (50%), followed by diarrhoea (37.5%) and nausea (37.5%). In a phase 1b/2 study of metastatic microsatellite-stabilised colorectal cancer at the City of Hope Comprehensive Cancer Centre, 56.6% of 46 patients treated with anti-CTLA4 combined with pembrolizumab experienced grade 1 or 2 AEs, and 10.8% experienced grade 3 AEs. A DCR of 71.0% was achieved in 31 patients. In particular, in eight patients with pMMR/MSS colorectal cancer who had been shown in clinical studies to be unresponsive to PD1 immunotherapy, the combination treatment resulted in a 62.5% DCR, with one patient achieving CR, two patients achieving PR, two patients exhibiting SD, and a 12-month OS rate of 25%, suggesting that eliglustat has the ability to increase the exposure of neoantigens and recruit T cells, thereby triggering an antitumour response. Surprisingly, three of the 31 patients enrolled achieved CR for more than 11 months, the longest CR having been for more than 21.6 months. Thus, the combination of eliglustat with an anti-PD1 antibody may represent a potential immunotherapy strategy in which eliglustat can convert ‘cold’ tumours lacking neoantigens and infiltrating T cells into ‘hot’ tumours.
Although we have shown that eliglustat combined with an anti-PD-1 antibody can achieve an antitumour response in low-immunogenicity tumour models or patients with pMMR/MSS colorectal cancer, many potential issues remain unresolved. For example, the therapeutic effects in the model mice may not mimic those in humans. We consider that there may be two possible reasons for this. 1) As the GSL synthesis inhibitor we used is a drug used to treat human Gaucher’s disease, its blood drug concentration is influenced by CYP2D6 and CYP3A metabolic enzymes. Therefore, it cannot be ruled out that differences in metabolic rate between different species may affect the treatment effect. 2) In this study, we did not identify which type of GSL plays a major role, and the background level of GSL on the surface of tumour cells may be one of the important factors affecting the enhanced antitumour effect after eliglustat treatment. Moreover, we also observed that this combination therapy exhibits differential efficacy for patients with different types of tumours. In addition to differences in drug metabolism and GSL expression levels, the speed of disease progression and the strength of inhibitory factors in the tumour microenvironment may be two other important factors affecting therapeutic efficacy since tumours that progress too quickly prevent a sufficient response time window for this therapy. We noted that not only primary hepatocellular carcinoma but also colorectal cancer with active liver metastasis are not sensitive to this therapy, with only one out of three patients achieving disease stability. Therefore, subsequent phase II clinical studies on pMMR/MSS colorectal cancer patients need to exclude such patients. As a proof-of-concept study, we detected elevated levels of various cytokines in PB and observed an increase in T-cell clone diversity but have not yet identified biomarkers that are significantly correlated with prognosis. In phase II clinical studies for pMMR/MSS colorectal cancer, we will attempt to identify potential biomarkers from tumour cells through techniques such as mass spectrometry to predict the efficacy of this combination therapy in advance and identify the patient population that benefits from this combination treatment.
Methods
Study design
The open-label, proof-of-concept, phase 1 clinical trial was conducted in accordance with the International Conference on Harmonization Guidelines for Good Clinical Practice and was approved by the Institutional Review Board of the Chinese PLA General Hospital (S2021-423-02), and registered with ClinicalTrial.gov (link: https://clinicaltrials.gov/study/NCT04944888, date: 06/23/2021). The enrolment was from 1 October 2021 (first patient) to 22 March 2023 (last patient). Each enrolled patient provided written informed consent in accordance with the ethical guidelines of the Declaration of Helsinki. The study protocol was approved by the Institutional Review Board of the General Hospital of the Chinese PLA General Hospital. All clinical investigations were conducted in accordance with the Declaration of Helsinki principles. All authors strictly followed the study protocol and steps, guaranteed the accuracy and completeness of the data. Initially, 84 mg of eliglustat was administered once daily for the first 14 days and thereafter every other week for 24 weeks. After clinical evaluation revealed no grade 3 or higher toxicities, we increased the dose to 168 mg in the remaining patients still on treatment. Immune checkpoint inhibitors, as confirmed by the physician, were intravenously administered on day 5 or day 15 every 3 weeks. For participants who continued to benefit from the study, the immune checkpoint inhibitor was administered every 3 weeks for 96 weeks. The study protocol is available in the Supplementary Information file.
As planned in the study protocol, we were originally going to analyse the relationship between eliglustat pharmacokinetics and anti-tumour response. Eliglustat is primarily metabolized by cytochrome P450 2D6 (CYP2D6), and variants in the gene encoding this enzyme, which lead to extensive, intermediate, or poor metabolizer phenotypes respectively, so the CYP2D6 genotyping are important determinants of eliglustat pharmacokinetics. However, all the patients enrolled belonged to the extensive metabolizer through genetic analysis, so we did not continue to perform the pharmacokinetic analysis of eliglustat.
Patients
Thirty-one patients were enrolled in this trial. The median age was 55 years (range: 23–72 years), and 42% of the patients were males. Patients enrolled had an Eastern Cooperative Oncology Group performance-status score of no more than two. The enrolled patients included eight individuals with colorectal cancer, three individuals with squamous cell carcinoma, four individuals with breast cancer, five individuals with Hodgkin’s lymphoma, four individuals with primary hepatocellular carcinoma, two individuals with non-Hodgkin’s lymphoma, one individual with gastric carcinoma, one individual with ovarian carcinoma, two individuals with oropharyngeal cancer and one individual with cervical adenocarcinoma. The enrolled patients had a clear pathological diagnosis of malignancy, were not amenable to radical surgery or presented with local/distant metastases, and had an expected survival of greater than 6 months. Previous immunotherapy (anti-PD1 antibody, anti-PD-L1 antibody) was not a limiting entry condition. All enrolled patients provided consent for the publication of potentially identifying clinical information. The authors affirm that the patient provided informed consent for publication of the images in Supplementary Fig. S21.
Mice
Six- to eight-week-old C57BL/6J, NTG, and BALB/c nude mice were purchased from SPF Biotechnology Co., Ltd., and maintained at the animal facility of the Chinese PLA General Hospital. Tumour engraftment was performed at age 6–8 weeks. OT-I, OT-II and Batf3−/− mice were obtained from Jackson Laboratory. We used a humane protocol in xenograft tumour growth assay with the endpoints of tumour volume <2000 mm3 permitted by the Animal Ethics Committee of Chinese PLA General Hospital. In some cases, this limit has been exceeded the last day of measurement and the mice were immediately euthanized. 4T1 cells were injected in female C57BL/6 J mice. MC38-OVA, B16F10-OVA, MC38, CT26, A20 and EG7 cells were injected in male mice. Both male and female Batf3−/− mice were used. All mice were maintained in a specific pathogen-free environment at Chinese PLA General Hospital. All animal experiments were approved by the Animal Ethics Committee of Chinese PLA General Hospital.
Cells and cell culture
MC38-OVA, B16F10-OVA, MC38, CT26, 4T1, A20 and EG7 cells were purchased from the American Type Culture Collection (ATCC), and cells were cultured in RPMI-1640 (Gibco, USA) supplemented with 10% foetal bovine serum (Gibco), 100 U/mL penicillin and 100 mg/mL streptomycin (Gibco).
Antibodies and reagents
Anti-CD3ε-PerCP (100326, FACS 1:100), anti-CD8a-AF700 (100730, FACS 1:100), anti-CD8a-APC (100712, FACS 1:100), anti-PD-1-PE/DZ594 (109116, FACS 1:100), anti-Ki67-FITC (652410, FACS 1:100), anti-IFN-γ-BV421 (505830, FACS 1:100), anti-IFN-γ-PerCp/Cy5.5 (505822, FACS 1:100), anti-TNF-α-APC/Cy7 (506344, FACS 1:100), anti-TIM-3-PE/Cy7 (119716, FACS 1:100), anti-CD45-BV510 (103138, FACS 1:100), anti-CD107a-APC (344724, FACS 1:100) purified anti-mouse CD3ε (100340), and purified anti-mouse CD28 (102116) were obtained from Biolegend. Anti-CD8-FITC (D271-4, FACS 1:100) and Tetramer-SIINFEKL-APC (TS-5001-2c, FACS 1:100) were purchased from MBL. The cell stimulation cocktail plus protein transport inhibitors were purchased from eBioscience. Naive CD8a+ T-cell isolation and tumour dissociation kits were obtained from Miltenyi Biotec. Mouse anti-CD8 depleting antibody (Clone 2.43) and anti-CD4 depleting antibody (Clone GK1.5) were purchased from BioXcell. Eliglustat and miglustat were purchased from MedChemExpress. For human intracellular cytokine expression, a T-cell stimulation kit (including PMA, ionomycin, and transporter protein inhibitor 00-4975-93) was purchased from eBioscience. Anti- mouse UGCG antibody (12869-1-AP, WB 1:1000) was obtained from Proteintech. Anti-mouse GAPDH (D4C6R, WB 1:2000) antibody was purchased from Cell Signaling Technology. The cells were stained with anti-CD3 APC-CY7 (557832, BD Bioscience, FACS 1:100), CD4 FITC (555366, BD Bioscience, FACS 1:100), CD8 Alexa Fluor 700 (557922, BD Bioscience, FACS 1:100), CD45 PerCP (368506, BioLegend, FACS 1:100), CD45RA Alexa Fluor 647 (304154, BioLegend, FACS 1:100), CD62L PerCP (304824, BioLegend, FACS 1:100), CD25 Brilliant Violet 421TM (356114, BioLegend, FACS 1:100), Granzyme B Brilliant Violet 421TM (396414, BioLegend, FACS 1:100) IFN-γ PerCP (506528, BioLegend, FACS 1:100), TNF-α Brilliant Violet 421TM (502932, BioLegend, FACS 1:100) and isotype-matched antibodies (BD Bioscience and BioLegend, FACS 1:100). All data were analysed using Kaluza Analysis 1.5.
T-cell isolation and in vitro treatment
Spleens from OT-I and OT-II transgenic mice (6–8 weeks old) were added to the tissue diluent and the mixture was strained through a 70 μm nylon cell strainer (BD Falcon). The mixture was slowly added to mouse lymphocyte isolation medium (Solarbio) by centrifugation at 700 g for 20 min. The naive OVA-specific CD8+ T cells were purified using the Mouse Naive CD8+ T-Cell Isolation Kit according to the manufacturer’s instructions. Naïve CD8+ T cells were then seeded at a cell concentration of 3 × 106 cells/mL in 24-well plates preactivated with anti-CD3 (10 μg/mL) and anti-CD28 (10 μg/mL) antibodies in RPMI-1640 medium supplemented with 10% FBS, 100 U/mL penicillin, 100 mg/mL streptomycin and recombinant IL-2 (200 U/mL).
Cell viability analysis using CCK8 assays
To determine the cytotoxicity of eliglustat, a CCK8 colorimetric assay was performed (MedChemExpress). MC38-OVA (1 × 104) and CD8+ T cells (1 × 105) were seeded in 96-well plates and incubated in an incubator with 5% CO2 at 37 °C until adherence. Different concentrations of eliglustat were used to treat the cells for 24 h. Then, 10 µL of CCK8 reagent was added to each well, the cells were further incubated for 4 h, and the absorbance of each well was measured using a microplate reader (Model 680, Bio-Rad, USA) at a wavelength of 450 nm. All assays were carried out in triplicate, and 10% and 50% cytotoxic concentrations (IC10, IC50) were calculated. 5-Fluorouracil was used as a positive control.
Apoptosis assays
MC38-OVA and CD8+ T cells were cultured with eliglustat for 48 h. The cells were collected by trypsinization and stained with an Annexin V-FITC staining kit (BD). The cells were analysed by flow cytometry, and the FITC+ cells were determined to be apoptotic cells.
In vitro killing assays
For the in vitro killing assays, GFP-labelled MC38-OVA, B16-F10-OVA, or OVCAR3 cells were cultured for 48 h with PBS or 400 nM eliglustat. The cells were washed with PBS, and 5 × 103 cells were seeded into 96-well flat-bottom plates. Target cells were incubated with activated OT-I CD8 T cells, OT-II CD4 T cells or NY-ESO-1 T cells for 24 h at the indicated effector-to-target ratios. After 24 h of coculture, the numbers of GFP+ cells were quantified using flow cytometry.
2D clonogenic assays
Cells were plated in 6-well plates at 300 cells per well in 2 ml DMEM supplemented with 10% FBS with eliglustat (400 nM). After 14 days, colonies were fixed with 80% methanol, stained with 0.2% crystal violet, and counted.
Tumour models
For tumour experiments, 6- to 8-week-old male or female mice were used. MC38-OVA, B16F10-OVA, CT26, 4T1, A20, and EG7 cells were harvested, washed twice with PBS and resuspended. The tumour cell suspensions were subcutaneously injected into the right flanks of the mice. For the eliglustat and miglustat groups, eliglustat (10 mg/kg/day) or miglustat (10 mg/kg/day) was administered starting on the day the mice were loaded with tumours. For the FTY-720 group, FTY-720 (100 mg/kg/day, Selleck Chemicals) was administered 2 times a week. Tumour volume and overall health score, as well as body weights, were estimated every other day, and tumour volume (in mm3) was calculated according to the formula (length × width2)/2. For the a-PD-1 and a-CTLA-4 groups, 200 μg of anti-PD-1 (Clone RMP1-14, BioXCell) or anti-CTLA-4 antibody (Clone 9D9, BioXCell) was intraperitoneally (i.p.) administered twice weekly. Mice were euthanized before the tumour size reached 2000 mm3. Animals that developed ulcerative tumours were euthanized and excluded from further analysis. For the 400 nM eliglustat-treated group, MC38-OVA or B16F10-OVA cells were treated with 400 nM eliglustat for 72 h, washed twice with PBS and then resuspended. The tumour cell suspensions were subcutaneously injected into the flanks of the mice.
Lymphocyte depletion
To evaluate the role of specific immune effector cell subsets in mice, we depleted CD4+ T cells, CD8+ T cells or natural killer cells using 150 μg of intraperitoneally injected anti-CD4 antibody (BioXcell, clone GK1.5), 100 μg of anti-CD8β antibody (BioXcell, clone 2.43) or 200 μg of anti-NK1.1 antibody (BioXcell, clone PK136), respectively, on days –3, 0, 3 and 8 beginning 1 day prior to eliglustat therapy. Equal amounts of IgG isotype antibodies (BioXcell) were injected as a control. Mice were euthanized before the tumour size reached 2000 mm3. Animals that developed ulcerative tumours were euthanized and excluded from further analysis.
Measurement of IFN-γ-secreting T cells by ELISPOT assay
CD8+ T cells were isolated from the tumours, PB, and dLNs of MC38 tumour-bearing mice. A total of 1 × 105 CD8+ T cells were used for the assay. MC38 and 4T1 cells were irradiated with a single dose of 30 Gy. The ratio of MC38 to immune cells was 1:4. After 24 h of incubation, IFN-γ production was determined with an IFN-γ ELISPOT Assay Kit (Abcam) according to the manufacturer’s protocol. The visualized cytokine spots were enumerated with an ImmunoSpot S6 Analyser (Cellular Technology Limited).
TCRβ repertoire analysis from tumour-infiltrating lymphocytes
Vehicle and eliglustat-treated tumour and spleen samples were collected. TCRβ variable region genes were amplified through RT‒PCR using RNA extracted from the tumour and spleen and then sequenced. Sequencing results were processed, and a TCRβ repertoire containing 30,000 functional TCRβ sequences, with a V-D-J junction that revealed the recombination of a TCRβ peptide with a nonempty CDR3 region, was prepared for each sample. The diversity of the TCRβ repertoire was measured by the diversity 50 (D50) value, clone number and CDR3 length. Data were analysed using ImmunoSEQ Analyser 3.0, an Adaptive Biotechnologies online analysis platform.
Conjugate assay
Vehicle and eliglustat-treated MC38-OVA tumour cells were stained with CFSE (eBioscience) at 37 °C for 15 min. OT-1 T cells were stained with an anti-CD8-AF700 antibody at 37 °C for 15 min. For conjugation, 5 × 105 T cells were mixed with 2.5 × 105 tumour cells in a 5 mL round bottom test tube, centrifuged at 300 g, and incubated at 37 °C for different times. T-tumour cell conjugates were analysed by flow cytometry immediately after resuspension of the cell pellet by vortexing for 30 s.
Flow cytometry analysis
To detect the phenotype and function of tumour-infiltrating lymphocytes, tumour-bearing mice were sacrificed to collect tumour samples. For the preparation of single-cell suspensions from mouse tumours, tumour tissues were cut with scissors in 2 mL of cold RPMI-1640 medium without FBS. Tumour fragments were then enzymatically digested with a tumour dissociation reagent at 37 °C. After incubation, digested tumour suspensions were passed through a 70 μm nylon cell strainer and rinsed twice with cold PBS, and the cells were resuspended in RPMI-1640 medium without FBS. The obtained single-cell suspensions were used for flow cytometry. Surface staining was performed with the indicated antibodies for 15 min at 4 °C or Tetramer-SIINFEKL mAb for 45 min according to the manufacturer’s instructions. For intracellular antigens, IFN-γ and TNF-α were detected after stimulation with a cell stimulation cocktail with protein transport inhibitors for 5 h. Cells were first stained with surface antibodies and then fixed and permeabilized using a Foxp3/ transcription factor (TF) staining buffer followed by intracellular antibody staining. After incubation, the cells were washed and suspended in buffer and then loaded into a DxFLEX instrument (Beckman Coulter). Data were analysed using CytExpert and Kaluza software (Beckman Coulter). Gating strategies are shown in Supplementary Fig. S21.
Establishment of UGCG knockout cells
The sgRNA sequences targeting UGCG (GAAGAGCACGAAGCCGAACA) was cloned into a lentiCRISPRv2 vector and confirmed by sequencing. The sgRNA sequences (GCGAGGTATTCGGCTCCGCG) that cannot target any genes are set as a control. The oligonucleotides mentioned above were ordered from Beijing Genomics Institute. MC38-OVA cells were infected with sgUGCG or control sgRNA lentivirus supernatants. Infected cells were selected for puromycin resistance.
CyTOF assay
The tumour tissues were minced and dissociated into single-cell suspensions using a tissue dissociation kit (Miltenyi). Cells were incubated with 0.25 μM cisplatin-194Pt at 4 °C for 5 min, washed and incubated with blocking solution at 4 °C for 20 min, followed by staining with a metal-conjugated surface antibody at 4 °C for 30 min. Cells were then fixed and permeabilized with Foxp3/TF staining buffer and stained with a DNA intercalator (0.25 μM iridium-191/193) at 4 °C overnight. After washing, the cells were incubated with a metal-conjugated intracellular antibody mixture at 4 °C for 30 min. The cells were then washed once in FACS and twice in ddH2O. Data were acquired using a CyTOF Helios mass cytometer (Fluidigm), normalized to the EQ bead signal, debarcoded using a doublet filtering scheme, and analysed by using FlowJo v10.0.7.
Immunohistochemistry
For immunohistochemical staining, sections from mouse tumour tissue were prepared according to the manufacturer’s protocol using the Rabbit HRP/DAB Detection IHC kit (Abcam, ab64261). Buffered formalin (Fisher)-fixed mouse tumour samples were mounted onto slides and stained using the following primary antibodies: F4/80 (Abcam, ab6640), CD4 (Abcam, ab183685), CD8 (Abcam, ab217344) and CD103 (Abcam, ab224202) overnight at 4 °C. Next, the sections were incubated with a biotinylated goat anti-rabbit IgG and streptavidin peroxidase (Abcam. ab64261) at room temperature for 2 h. Slides were washed with PBS, and counterstaining was performed using 100 µl diaminobenzidine at room temperature for 1 min and haematoxylin at room temperature for 1 min. Histopathological assessment and immunohistochemical staining analysis were performed using a light microscope.
Metabolomic analyses
Metabolomic profiling was performed according to a standardized workflow. A detail description of the mass spectrometry experiments is available in the Supplementary Information file.
Efficacy assessments
For subjects diagnosed with previously treated solid tumours, tumour response was evaluated by Response Evaluation Criteria in Solid Tumours (RECIST 1.1). This part of the protocol has been excerpted from the full RECIST 1.1 criteria. For information pertaining to RECIST 1.1 criteria not contained in the study protocol, please refer to the full publication52. Complete remission (CR): Disappearance of all target lesions. Any pathological lymph nodes (whether target or nontarget) must have a reduction in the short axis to <10 mm. PR: At least a 30% decrease in the sum of diameters of target lesions, taking as reference the baseline sum diameters. Progressive disease (PD): At least a 20% increase in the sum of diameters of target lesions, taking as reference the smallest sum on study (this includes the baseline sum if that is the smallest on study). In addition to the relative increase of 20%, the sum must also demonstrate an absolute increase of at least 5 mm (note: the appearance of one or more new lesions is also considered progression). SD: Neither sufficient shrinkage from the baseline study to qualify for PR nor sufficient increase to qualify for PD, taking as reference the smallest sum diameters on study.
The objective remission rate is defined as the proportion of patients whose tumour volume is reduced to a prespecified value according to accepted remission assessment criteria (e.g., RECIST version 1.1 for solid tumours) for the needed minimum duration.
The DCR is defined as the proportion of patients whose tumours are in remission (PR + CR) or stable (SD) after treatment for the minimum required duration according to accepted criteria for the assessment of remission (e.g. RECIST version 1.1 for solid tumours).
Special notes: (1) Lymph nodes identified as target lesions should always have the actual short axis measurement recorded and should be measured in the same anatomical plane as the baseline examination, even if the nodes regress to below 10 mm on study. This means that when lymph nodes are included as target lesions, the ‘sum’ of lesions may not be zero even if complete response criteria are met, since a normal lymph node is defined as having a short axis of <10 mm. (2) If the lesion is believed to be present and is faintly seen but too small to measure, a default value of 5 mm should be assigned (note: in case of a lymph node believed to be present and faintly seen but too small to measure, a default value of 5 mm should be assigned in this circumstance as well). This default value is derived from the 5 mm CT slice thickness (but should not be changed with varying CT slice thickness). (3) When a lesion becomes difficult to assign an exact measure and if it is the opinion of the radiologist that the lesion has likely disappeared, the measurement should be recorded as 0 mm. (4) When nonnodal lesions split into ‘fragments’ on treatment, the longest diameters of the fragmented portions should be added together to calculate the target lesion sum. Similarly, as lesions coalesce, a plane between them may be maintained that would aid in obtaining maximal diameter measurements of each individual lesion. If the lesions have coalesced such that they are no longer separable, the vector of the longest diameter in this instance should be the maximal longest diameter for the ‘coalesced lesion’. (5) If a subject has a tumour assessment that cannot be evaluated, then the subject will be assigned a visit response of not evaluable (unless there is evidence of progression in which case the response will be assigned as PD). (6) Additional imaging assessments may be performed at any time during the study when the investigator decides to support the efficacy evaluations for a subject, as necessary.
For subjects diagnosed with advanced relapsed or refractory haematological malignancies, tumour response will be evaluated by the Revised Response Criteria for Malignant Lymphoma (the 2014 Lugano classification). This part of the protocol has been excerpted from the full 2014 Lugano criteria. For information pertaining to the 2014 Lugano criteria not contained in the study protocol, please refer to the full publication53. CR: Complete disappearance of all detectable clinical and radiographic evidence of disease and disappearance of all disease-related symptoms if present before therapy and normalization of those biochemical abnormalities (for example, LDH) definitely assignable to the lymphoma. All lymph nodes must have regressed to normal size (less than or equal to 1.5 cm in greatest diameter if >1.5 cm before therapy). Previously involved nodes that were 1.1–1.5 cm in greatest diameter must have decreased to less than or equal to 1 cm or by more than 75 percent of the sum of the products with the greatest diameters. The spleen, if considered enlarged before therapy, must have regressed in size and not be clearly enlarged during physical examination. The bone marrow must show no evidence of disease by histology. Flow cytometry, molecular or cytogenetic studies cannot be used to determine response. The response must persist for 1 month. For FDG-avid or PET-positive lesions prior to therapy, a mass of any size is permitted if the current scan is PET negative. For variably FDG-avid or PET-negative lesions, regression to normal size on CT is needed. PR: ≥50% decrease in the sum of the products of diameters (SPD) of the 6 largest dominant nodes or nodal masses. There is no increase in the size of the nodes, liver or spleen and no new sites of disease. Splenic and hepatic nodules must regress by ≥50% in SPD. Bone marrow is irrelevant for the determination of a PR. No new sites of disease should be observed. For FDG-avid or PET-positive lesions prior to therapy, one or more PET-positivity at a previously involved site is permitted. For variably FDG-avid or PET-negative lesions, regression on CT is needed. PD: ≥s50% increase from the nadir of any previously identified abnormal node for PRs or nonresponders. Appearance of any new lesion during or at the end of therapy. SD: defined as less than a PR but not PD. All assessments of clinical response will be made according to the NHL guidelines.
Safety evaluation
AEs were continuously assessed during the study and for 90 days after the last treatment. The AEs were evaluated according to the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE) (Version 5.0). For those events without assigned CTCAE grades, the severity scale of mild, moderate, severe and life-threatening, corresponding to grades 1–5 was used. There were 31 enrolled patients in this trial. AEs were collected from the time of receiving the products throughout the treatment period and follow-up period.
Sample size
The sample size of this study is not based on statistical consideration, but rather depends on the number of observed toxicities and clinical or regulatory considerations. Patients enrolled and who discontinue from the study during the first treatment cycle for reasons other than DLT may be replaced. The statistical analysis is primarily descriptive in keeping with the exploratory nature of the study.
Statistical analyses
Statistical analyses were performed using GraphPad Prism 9.0. All in vitro studies were performed at least three biological replicates with similar results. Data points represent biological replicates and are displayed as the mean ± SEM. Statistical comparisons between groups were analysed using unpaired two-sided t test. P value < 0.05 was considered significant. Differences among multiple groups were assessed using two-way repeated measures ANOVA. A P value < 0.05 was considered to indicate statistical significance. Multiple testing was not conducted somewhere, which may increase the false positive error.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
The metabolomics/lipidomics data generated in this study have been deposited in the Open Archive for Miscellaneous Data under accession code OMIX007047. TCR sequencing data generated in this study have been deposited in the Genome Sequence Archive in the National Genomics Data Center, China National Center for Bioinformation, under accession code HRA008153 for human peripheral blood T cells and CRA018126 for mouse spleen and tumour tissues. Human TCR sequencing data (HRA008153) are available under restricted access due to patient privacy reasons. Access can be obtained by completing the application form via GSA Human System or by contacting the corresponding authors. Upon request after publication and ending 3 years following article publication to researchers who provide a detailed description of research protocol, additional individual deidentified participant data can be shared for clinical study analyses. Any request should be sent to the corresponding author, Weidong Han. The clinical trial study protocol is available in the Supplementary Information file. All remaining data can be found in the article, Supplementary Information, and Source Data files. Source data are provided with this paper.
References
Hakomori, S. Aberrant glycosylation in tumors and tumor-associated carbohydrate antigens. Adv. cancer Res. 52, 257–331 (1989).
Chang, W. W. et al. Expression of Globo H and SSEA3 in breast cancer stem cells and the involvement of fucosyl transferases 1 and 2 in Globo H synthesis. Proc. Natl. Acad. Sci. 105, 11667–11672 (2008).
Ho, M. Y., Yu, A. L. & Yu, J. Glycosphingolipid dynamics in human embryonic stem cell and cancer: their characterization and biomedical implications. Glycoconj. J. 34, 765–777 (2017).
Lou, Y. W. et al. Stage-specific embryonic antigen-4 as a potential therapeutic target in glioblastoma multiforme and other cancers. Proc. Natl. Acad. Sci. 111, 2482–2487 (2014).
Yu, J., Hung, J. T., Wang, S. H., Cheng, J. Y. & Yu, A. L. Targeting glycosphingolipids for cancer immunotherapy. FEBS Lett. 594, 3602–3618 (2020).
Guan, F., Handa, K. & Hakomori, S. I. Specific glycosphingolipids mediate epithelial-to-mesenchymal transition of human and mouse epithelial cell lines. Proc. Natl. Acad. Sci. 106, 7461–7466 (2009).
Cumin, C. et al. Glycosphingolipids are mediators of cancer plasticity through independent signaling pathways. Cell Rep. 40, 111181 (2022).
Hakomori, S. & Zhang, Y. Glycosphingolipid antigens and cancer therapy. Chem. Biol. 4, 97–104 (1997).
Radin NS. Chemotherapy by slowing glucosphingolipid synthesis. Biochem. Pharmacol. 57, 589–595 (1999).
Gouaze-Andersson, V. & Cabot, M. C. Glycosphingolipids and drug resistance. Biochim. Biophys. Acta 1758, 2096–2103 (2006).
Biswas, S. et al. Elevated levels of select gangliosides in T cells from renal cell carcinoma patients is associated with T cell dysfunction. J. Immunol. 183, 5050–5058 (2009).
Lee, H. C. et al. Ganglioside inhibition of CD8+ T cell cytotoxicity: interference with lytic granule trafficking and exocytosis. J. Immunol. 189, 3521–3527 (2012).
Ladisch, S., Becker, H. & Ulsh, L. Immunosuppression by human gangliosides: I. Relationship of carbohydrate structure to the inhibition of T cell responses. Biochim. Biophys. Acta 1125, 180–188 (1992).
Grayson, G. & Ladisch, S. Immunosuppression by human gangliosides. II. Carbohydrate structure and inhibition of human NK activity. Cell. Immunol. 139, 18–29 (1992).
Cheever, M. A. et al. The prioritization of cancer antigens: a national cancer institute pilot project for the acceleration of translational research. Clin. Cancer Res. 15, 5323–5337 (2009).
Yu, A. L., Hung, J. T., Ho, M. Y. & Yu, J. Alterations of glycosphingolipids in embryonic stem cell differentiation and development of glycan-targeting cancer immunotherapy. Stem Cells Dev. 25, 1532–1548 (2016).
Lloyd, K. O. & Old, L. J. Human monoclonal antibodies to glycolipids and other carbohydrate antigens: dissection of the humoral immune response in cancer patients. Cancer Res. 49, 3445–3451 (1989).
Yvon, E. et al. Immunotherapy of metastatic melanoma using genetically engineered GD2-specific T cells. Clin. Cancer Res. 15, 5852–5860 (2009).
Del Bufalo, F. et al. GD2-CART01 for relapsed or refractory high-risk neuroblastoma. N. Engl. J. Med. 388, 1284–1295 (2023).
Ladenstein, R. et al. Interleukin 2 with anti-GD2 antibody ch14.18/CHO (dinutuximab beta) in patients with high-risk neuroblastoma (HR-NBL1/SIOPEN): a multicentre, randomised, phase 3 trial. Lancet Oncol. 19, 1617–1629 (2018).
Lo, A. S., Ma, Q., Liu, D. L. & Junghans, R. P. Anti-GD3 chimeric sFv-CD28/T-cell receptor zeta designer T cells for treatment of metastatic melanoma and other neuroectodermal tumors. Clin. Cancer Res. 16, 2769–2780 (2010).
Ponath, P. et al. A novel, fully human anti-fucosyl-GM1 antibody demonstrates potent in vitro and in vivo antitumor activity in preclinical models of small cell lung cancer. Clin. Cancer Res. 24, 5178–5189 (2018).
Biellmann, F., Hülsmeier, A. J., Zhou, D., Cinelli, P. & Hennet, T. The Lc3-synthase gene B3gnt5 is essential to pre-implantation development of the murine embryo. BMC Dev. Biol. 8, 109 (2008).
Allende, M. L. & Proia, R. L. Simplifying complexity: genetically resculpting glycosphingolipid synthesis pathways in mice to reveal function. Glycoconj. J. 31, 613–622 (2014).
D’Angelo, G., Capasso, S., Sticco, L. & Russo, D. Glycosphingolipids: synthesis and functions. FEBS J. 280, 6338–6353 (2013).
Merrill, A. H. Jr Sphingolipid and glycosphingolipid metabolic pathways in the era of sphingolipidomics. Chem. Rev. 111, 6387–6422 (2011).
Giraudo, C. G. & Maccioni, H. J. Ganglioside glycosyltransferases organize in distinct multienzyme complexes in CHO-K1 cells. J. Biol. Chem. 278, 40262–40271 (2003).
Jongsma, M. L. M. et al. The SPPL3-defined glycosphingolipid repertoire orchestrates HLA class I-mediated immune responses. Immunity 54, 132–150.e139 (2021).
Yan, X. et al. CD58 loss in tumor cells confers functional impairment of CAR T cells. Blood Adv. 6, 5844–5856 (2022).
Lavie, Y. et al. Agents that reverse multidrug resistance, tamoxifen, verapamil, and cyclosporin A, block glycosphingolipid metabolism by inhibiting ceramide glycosylation in human cancer cells. J. Biol. Chem. 272, 1682–1687 (1997).
Fukumoto, H., Nishio, K., Ohta, S., Hanai, N. & Saijo, N. Reversal of adriamycin resistance with chimeric anti-ganglioside GM2 antibody. Int. J. cancer 67, 676–680 (1996).
Stirnemann, J. et al. A review of Gaucher disease pathophysiology, clinical presentation and treatments. Int. J. Mol. Sci. 18, 441 (2017).
Vykoukal, J. et al. Caveolin-1-mediated sphingolipid oncometabolism underlies a metabolic vulnerability of prostate cancer. Nat. Commun. 11, 4279 (2020).
Shurin, G. V. et al. Neuroblastoma-derived gangliosides inhibit dendritic cell generation and function. Cancer Res. 61, 363–369 (2001).
Caldwell, S. et al. Mechanisms of ganglioside inhibition of APC function. J. Immunol. 171, 1676–1683 (2003).
Blank, N., Schiller, M., Gabler, C., Kalden, J. R. & Lorenz, H. M. Inhibition of sphingolipid synthesis impairs cellular activation, cytokine production and proliferation in human lymphocytes. Biochem. Pharmacol. 71, 126–135 (2005).
Mosely, S. I. et al. Rational selection of syngeneic preclinical tumor models for immunotherapeutic drug discovery. Cancer Immunol. Res. 5, 29–41 (2017).
Gong, N. et al. Proton-driven transformable nanovaccine for cancer immunotherapy. Nat. Nanotechnol. 15, 1053–1064 (2020).
Lechner, M. G. et al. Immunogenicity of murine solid tumor models as a defining feature of in vivo behavior and response to immunotherapy. J. Immunother. 36, 477–489 (2013).
Varki, A. Since there are PAMPs and DAMPs, there must be SAMPs? Glycan “self-associated molecular patterns” dampen innate immunity, but pathogens can mimic them. Glycobiology 21, 1121–1124 (2011).
Varki, A. & Gagneux, P. Multifarious roles of sialic acids in immunity. Ann. N.Y. Acad. Sci. 1253, 16–36 (2012).
Hildner, K. et al. Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T cell immunity. Science 322, 1097–1100 (2008).
Ganesh, K. et al. Immunotherapy in colorectal cancer: rationale, challenges and potential. Nat. Rev. Gastroenterol. Hepatol. 16, 361–375 (2019).
Fantini, J., Hammache, D., Piéroni, G. & Yahi, N. Role of glycosphingolipid microdomains in CD4-dependent HIV-1 fusion. Glycoconj. J. 17, 199–204 (2000).
Moore, M. L., Chi, M. H., Goleniewska, K., Durbin, J. E. & Peebles, R. S. Jr Differential regulation of GM1 and asialo-GM1 expression by T cells and natural killer (NK) cells in respiratory syncytial virus infection. Viral Immunol. 21, 327–339 (2008).
Hodi, F. S. et al. Improved survival with ipilimumab in patients with metastatic melanoma. N. Engl. J. Med. 363, 711–723 (2010).
Van Allen, E. M. et al. Genomic correlates of response to CTLA-4 blockade in metastatic melanoma. Science 350, 207–211 (2015).
Snyder, A. et al. Genetic basis for clinical response to CTLA-4 blockade in melanoma. N. Engl. J. Med. 371, 2189–2199 (2014).
Garon, E. B. et al. Pembrolizumab for the treatment of non–small-cell lung cancer. N. Engl. J. Med. 372, 2018–2028 (2015).
Naiyer, A. et al. Cancer Immunology. Mutational landscape determines sensitivity to PD-1 blockade in non–small cell lung cancer.Science 348, 124–128 (2015).
Le, D. T. et al. PD-1 blockade in tumors with mismatch-repair deficiency. N. Engl. J. Med. 372, 2509–2520 (2015).
Eisenhauer, E. A. et al. New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur. J. Cancer 45, 228–247 (2009).
Cheson, B. D. et al. Recommendations for initial evaluation, staging, and response assessment of Hodgkin and non-Hodgkin lymphoma: the Lugano classification. J. Clin. Oncol. 32, 3059–3068 (2014).
Acknowledgements
We thank all of the members of Department of Bio-therapeutic for discussion and support. We also thank professor Zhixin Zhang (Chengdu EXAB Biotechnology Ltd.) for technical assistance and support. Eliglustat sponsored by the Beijing Kailai Tiancheng Pharmaceutical Technology Co., Ltd. is gratefully acknowledged. The sponsor had no role in the clinical trial study design, data collection and analysis or manuscript writing.
This work was supported in part by the National Natural Science Foundation of China (Nos. 82150108 (W.H.), 31991171 (W.H.), 82370226 (Z.W.) and 82341208 (W.H.)), the Translational Research Grant of NCRCH (2021WWC04 (W.H.)) and the Beijing Natural Science Foundation (7232160 (Z.W.)).
Author information
Authors and Affiliations
Contributions
L.D., Z.W., and W.H. designed the research. L.D., Z.C. and Y.Lu performed the experiments. Yang Z. and Z.M. assisted with the experiments. M.C., Y.Liu, Yan Z., K.F., Q.Y. and W.H. performed the clinical trial. L.D., Z.C., Y.W., X.M., Z.W. and W.H. analyzed the data and wrote the manuscript.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks Nicholas DeVito and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
About this article
Cite this article
Dong, L., Cao, Z., Chen, M. et al. Inhibition of glycosphingolipid synthesis with eliglustat in combination with immune checkpoint inhibitors in advanced cancers: preclinical evidence and phase I clinical trial. Nat Commun 15, 6970 (2024). https://doi.org/10.1038/s41467-024-51495-3
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-024-51495-3
This article is cited by
-
Metabolomic profiling reveals interindividual metabolic variability and its association with cardiovascular-kidney-metabolic syndrome risk
Cardiovascular Diabetology (2025)
-
Unraveling the glyco-immunity nexus in pancreatic cancer
Molecular Cancer (2025)
-
UGCG and the glycosphingolipid rheostat: a metabolic checkpoint governing immune activation and tumor immune evasion
Signal Transduction and Targeted Therapy (2025)
-
Engineering TCR-preserved allogeneic CAR-T cells: leveraging cancer immune evasion principles to establish T-cell tolerance
Cellular & Molecular Immunology (2025)
-
Identifying conserved metastatic pathways across cancers through integrated transcriptomic and network analysis
Medical Oncology (2025)
