A SnRK2-HAK regulatory module confers natural variation of salt tolerance in maize

Zhang, Ming; Zhou, Xueyan; Wang, Limin; Liang, Xiaoyan; Liu, Xin; Jiang, Caifu

doi:10.1038/s41467-025-59332-x

Download PDF

Article
Open access
Published: 29 April 2025

A SnRK2-HAK regulatory module confers natural variation of salt tolerance in maize

Nature Communications volume 16, Article number: 4026 (2025) Cite this article

5301 Accesses
3 Citations
2 Altmetric
Metrics details

Subjects

Abstract

The exclusion of sodium ions (Na⁺) from the shoot tissue, termed shoot Na⁺ exclusion, underlies a core mechanism of crop salt tolerance. Recent studies have shown that the HAK (High-Affinity K⁺ Transporter) family Na⁺ transporters play a key role in shoot Na⁺ exclusion of various crops, however, it is unknown whether and how this type of transporter is post-transcriptionally regulated. Here, we show that two closely related SnRK2 kinases, designated as ZmSnRK2.9 and ZmSnRK2.10, promote shoot Na⁺ exclusion and salt tolerance by activating the Na⁺ transporter ZmHAK4 in maize. Under salt conditions, the kinase activity of ZmSnRK2.9 and ZmSnRK2.10 is activated, then they interact with and phosphorylate ZmHAK4 at Ser5, increasing the Na⁺ transport activity of ZmHAK4, which in turn promotes salt tolerance by improving the exclusion of Na⁺ from the shoot tissue. Furthermore, we show that a 20-bp deletion that occurred naturally in the ZmSnRK2.10 promoter decreases its transcript level, resulting in an increased shoot Na⁺ content under salt conditions. Our findings support a breeding program that can utilize the favorable alleles of ZmHAK4 and ZmSnRK2.10 to enhance both the transcriptional and post-transcriptional activation of ZmHAK4, thus advancing the development of salt-tolerant maize.

Genome-wide association studies identify OsWRKY53 as a key regulator of salt tolerance in rice

Article Open access 15 June 2023

Sargassum-synthesized ZnO nanoparticles induce salt tolerance in maize plants through enhanced physiological and biochemical mechanisms

Article Open access 20 August 2025

Antioxidant production promotes defense mechanism and different gene expression level in Zea mays under abiotic stress

Article Open access 26 March 2024

Introduction

Salinity is an obstinate abiotic stress that exists widely in cultivation lands^1,2, which currently affects more than 45 million hectares of irrigated land worldwide, and the area of salt-affected lands is increasing due to global warming, extreme weather, and unreasonable irrigation³. Meanwhile, most crops are sensitive or moderately sensitive to salt stress, making soil salinity a major abiotic stress threatening the sustainability of worldwide agricultural production and food supply^3,4. In such a context, there is an urgent need to understand the mechanisms of salt tolerance and develop salt-tolerant crops, which, for one thing, can sustain agriculture on salt-affected farmlands, and for another, can turbocharge the utilization of the unexploited salt-affected wastelands.

Sodium ions (Na⁺) are the most abundant soluble cations in salinized fields. When growing in salinized farmlands, the crop uptakes a large amount of Na⁺, excessive of which being transported to the aboveground tissue will disrupt even overwhelming various physiological processes, including nutrient uptake, photosynthesis, growth, and so on^5,6,7. Previous studies have shown that the exclusion of Na⁺ from shoot tissue is one of the most important physiological processes that allow crops to tolerate salt stress^8,9,10, and the process is substantially controlled by Na⁺-preferential transporters and their regulators^2,3,11. Specifically, Na⁺ transporters from the NHX (Na⁺/H⁺ exchanger) family (e.g. Salt Overly Sensitive 1, SOS1) and their regulators constitute a network that promotes shoot Na⁺ exclusion by mediating Na⁺ efflux from the root to soil solution⁵. The Na⁺ transporters of the HKT1 (High-Affinity Potassium Transporter 1) family (e.g. SHOOT K⁺ CONTENT 1, SKC1; Na⁺ EXCLUSION 2, Nax2) together with their regulators promote shoot Na⁺ exclusion largely by mediating withdraw of Na⁺ from the root-to-shoot xylem flow^{12,13,14,15,16}. Recently, Na⁺-preferential transporters encoded by the HAK (High-Affinity K⁺ transporter) family genes (e.g. ZmHAK4; OsHAK12) have been shown to modulate crop salt tolerance by promoting the exclusion of Na⁺ from the shoot tissue^17,18, representing an important advancement in understanding the mechanism of shoot Na⁺ exclusion and providing a promising target gene for breeding salt-tolerant crops. Apparently, a better understanding of the mechanisms that transcriptionally and post-transcriptionally regulate the HAK family Na⁺ transporters will facilitate its application in breeding.

Sucrose non-fermenting-1-related protein kinase 2 (SnRK2), a type of serine/threonine protein kinases, is widely distributed throughout the plant kingdom^19,20,21. By phosphorylating substrates, SnRK2s regulate the expression and/or protein activity of downstream targets, then affect various physiological processes, including abiotic stress response, pathogen defense, stomatal movement, growth and development, and so on^{1,20,22,23,24,25,26,27,28,29}. For example, Arabidopsis SnRK2s phosphorylate the SLOW ANION CHANNEL-ASSOCIATED 1 (SLAC1) and the R-type anion channel QUAC1 to trigger stomatal closure and tolerance to drought stress^30,31. SnRK2s phosphorylate and activate various transcription factors (e.g. ABRE-BINDING FACTOR, ABF) to regulate the transcript levels of stress response genes³². Previous studies have also suggested that SnRK2 members play a role in plant response to salt stress^27,33. However, to date, molecular mechanisms that underlie the SnRK2-associated salt tolerance remain largely unclear. Specifically, it remains to study whether and how SnRK2s are involved in the regulation of core salt-tolerant processes (e.g., shoot Na⁺ exclusion).

Our previous study has shown that the Na⁺ transporter ZmHAK4 promotes maize salt tolerance by reinforcing the exclusion of Na⁺ from the shoot tissue¹⁷. Here, we show that two closely related SnRK2 protein kinases (ZmSnRK2.9 and ZmSnRK2.10) redundantly promote shoot Na⁺ exclusion and salt tolerance by activating ZmHAK4. We reveal that, under salt stress conditions, the kinase activity of ZmSnRK2.9 and ZmSnRK2.10 is activated, then they interact with ZmHAK4 and phosphorylate it at Ser5, enhancing the Na⁺ transport activity of ZmHAK4, thus promoting shoot Na⁺ exclusion and salt tolerance. Our study also uncovers that a 20-bp deletion in the ZmSnRK2.10 promoter decreased the transcription levels of ZmSnRK2.10, leading to natural diversity (increase) of shoot Na⁺ content under salt conditions. This study identified ZmSnRK2s-ZmHAK4 as a significant module that promotes the exclusion of Na⁺ from the shoot tissue, which provides an important molecular understanding of the salt tolerance mechanism, and a genetic target for the breeding of salt-tolerant maize varieties.

Results

ZmSnRK2.9 and ZmSnRK2.10 positively regulate maize salt tolerance

To identify genes that regulate salt tolerance in maize, we analyzed the salt phenotype of 1000 maize mutant lines, which were generated using CRISPR/Cas9-based approach by the Center for Crop Functional Genomics and Molecular Breeding, China Agricultural University. Subsequently, we found that two independent mutant lines lacking GRMZM2G066867, an SNF1-regulated protein kinase gene termed ZmSnRK2.10, were more sensitive to salt stress than wild type. These lines (designated as ZmSnRK2.10^crispr-1 and ZmSnRK2.10^crispr-2) conferred a 1-bp deletion and 1-bp insertion, respectively, and both of which lead to frameshift and truncation of the ZmSnRK2.10 protein (Supplementary Fig. 1a, b). These mutants were around 25% smaller than the wild-type plants under salt (100 mM NaCl) conditions (Fig. 1a–c), while there were no visible differences between ZmSnRK2.10^crispr mutants and the wild-type plants under control conditions, suggesting that ZmSnRK2.10 positively regulates maize salt tolerance.

The members of the SnRK2 family proteins in plants were classified into three subfamilies³⁴. We conducted a phylogenic analysis of maize SnRK2 proteins (n = 11) together with rice and Arabidopsis SnRK2 proteins using MEGA7^35,36. The results showed that ZmSnRK2.10, ZmSnRK2.8 and ZmSnRK2.9, along with AtSnRK2.6 (AtOST1), grouped into the third subfamily (Supplementary Fig. 2). ZmSnRK2.9 and ZmSnRK2.10 showed the highest (94.5%) homology of protein sequences (Supplementary Fig. 3), suggesting that ZmSnRK2.9 may also play a role in maize response to salt stress. To test this hypothesis, we generated two independent knockout lines of ZmSnRK2.9 (ZmSnRK2.9^crispr-1 and ZmSnRK2.9^crispr-2). They carried a 7-bp deletion and a 1-bp insertion, respectively, resulting in frameshift and truncation of the ZmSnRK2.9 protein (Supplementary Fig. 4a, b). Nevertheless, these ZmSnRK2.9^crispr mutants and wild-type plants did not show detectable differences under both control and salt treatment conditions (Supplementary Fig. 4c, d). Moreover, we generated the double mutant ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 and found that it was more sensitive to salt stress than the ZmSnRK2.10^crispr-1 mutants (Fig. 1d, e), displaying a biomass reduction of around 65% under salt conditions (Fig. 1f). These results suggested that ZmSnRK2.9 and ZmSnRK2.10 act redundantly in terms of promoting salt tolerance. Given that single-gene mutants lacking ZmSnRK2.10 but not lacking ZmSnRK2.9 show a salt-sensitive phenotype, we suggest that ZmSnRK2.10 plays a more critical role in promoting salt tolerance compared to ZmSnRK2.9.

The kinase activity of ZmSnRK2.9 and ZmSnRK2.10 increases in response to salt stress

Previous studies have shown that the adaptation of plants to various environmental stresses could be associated with an increase in the transcript levels, protein abundance, and kinase activity of SnRK2s^23,37. To determine what is the case for ZmSnRK2.9- and ZmSnRK2.10-mediated salt tolerance, we first analyzed their transcript levels (see Methods), and found that the control and salt-treated plants displayed comparable transcript levels of ZmSnRK2.9 and ZmSnRK2.10 in both root and shoot tissues (Fig. 1g, h). The results also showed that the transcript level of ZmSnRK2.10 was approximately 30 times that of ZmSnRK2.9 under both control and salt conditions, which may partially explain the above observation that lacking ZmSnRK2.9 alone leads to an undetectable salt phenotype (Fig. 1g, h). Next, we determined whether the abundance of ZmSnRK2.9 and ZmSnRK2.10 proteins changed upon salt treatment. Using an anti-SnRK2s antibody that simultaneously detects ZmSnRK2.9 and ZmSnRK2.10 (Supplementary Fig. 5), we found that the abundance of ZmSnRK2.9 and ZmSnRK2.10 proteins remains unchanged after the onset of salt treatment for up to 6 h (Fig. 1i). Moreover, we determined whether the kinase activity of ZmSnRK2.9 and ZmSnRK2.10 change upon salt stress. Using MyBP as substrate, the in-gel kinase assay revealed that salt treatment for 2 h significantly increases the kinase activity of ZmSnRK2.9 and ZmSnRK2.10 in wild-type plants, but not in ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 (Fig. 1j). These observations suggested that the kinase activity of ZmSnRK2.9 and ZmSnRK2.10 increases in response to salt stress, which could confer salt tolerance by activating its downstream targets.

ZmSnRK2.9 and ZmSnRK2.10 promote the exclusion of Na⁺ from shoot tissue

Previous studies have demonstrated that maize salt tolerance is positively correlated with its ability to exclude salt ions (Na⁺ and Cl^-) from the shoot tissue and to maintain shoot K⁺/Na⁺ homeostasis^7,17,38,39. We then analyzed the content of Na⁺, K⁺ and Cl^- content in shoot and root tissues of wild type, ZmSnRK2.9^crispr-1, ZmSnRK2.10^crispr-1 and ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 plants under control and salt (100 mM NaCl) conditions (Fig. 2). We observed that ZmSnRK2.9^crispr-1 and wild type exhibited a comparable tissue Na⁺ and K⁺ content under both control and salt conditions. By contrast, ZmSnRK2.10^crispr-1 displayed significantly more shoot Na⁺ and less root Na⁺ than the wild-type plants under salt conditions, and the phenotype is more notable in ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 (Fig. 2a, b). In addition, the salt-grown ZmSnRK2.10^crispr-1 and ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 showed a lower shoot K⁺ content and higher shoot Na⁺/K⁺ ratio than wild-type plants (Fig. 2c–f). Meanwhile, we observed that the wild type, ZmSnRK2.9^crispr-1, ZmSnRK2.10^crispr-1 and ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 exhibited a comparable shoot and root Cl^- content under both control and salt conditions (Fig. 2g, h). These results suggest that ZmSnRK2.9 and ZmSnRK2.10 promote salt tolerance by preventing the root-to-shoot translocation of Na⁺ and by maintaining shoot Na⁺/K⁺ homeostasis. To substantiate this conclusion, we measured the Na⁺ and K⁺ content in the xylem sap of the wild-type and mutant plants under control and salt conditions, and observed that the Na⁺ and K⁺ content in the xylem sap of ZmSnRK2.10^crispr-1 but not ZmSnRK2.9^crispr-1 were respectively higher and lower than that of the wild type, and the phenotype is more notable in ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 (Fig. 2i–k). These results indicate that ZmSnRK2.9 and ZmSnRK2.10 promote the exclusion of Na⁺ from the shoot largely by preventing root-to-shoot Na⁺ translocation.

**Fig. 2: ZmSnRK2.9 and ZmSnRK2.10 promote shoot Na⁺ exclusion by preventing the root-to-shoot Na⁺ translocation.**

ZmSnRK2.9 and ZmSnRK2.10 interact with the N-terminal of ZmHAK4

Our previous studies have shown that multiple Na⁺ transporters, including ZmHAK4, ZmHKT1;1 and ZmHKT1;2, cooperatively prevent root-to-shoot Na⁺ translocation^7,14,17, raising the possibility that the salt-activated ZmSnRK2.9 and ZmSnRK2.10 regulate Na⁺ transport by modulating the activity of these Na⁺ transporters through phosphorylation. To substantiate this speculation, we first analyzed the presence of ZmSnRK2.10 and ZmSnRK2.9 in tissue expressing ZmHAK4. Given that a previous study demonstrated that ZmHAK4 is predominantly expressed in root stele¹⁷, we investigated whether ZmSnRK2.10 and ZmSnRK2.9 are also expressed in the same tissue. We isolated the root stele from the outer part of the root following methods described in the previous study⁴⁰. Follow-up qRT-PCR assay revealed that both ZmSnRK2.10 and ZmSnRK2.9 were expressed at higher level in the stele where ZmHAK4 is predominantly found (Supplementary Fig. 6). Secondly, we examined the subcellular localization of ZmSnRK2.9 and ZmSnRK2.10 by expressing the fusion proteins ZmSnRK2.9-GFP and ZmSnRK2.10-GFP together with the plasma membrane-localized protein AtCBL1-OFP in maize protoplasts⁴¹, and observed that ZmSnRK2.9-GFP and ZmSnRK2.10-GFP were localized in the cytoplasm and nucleus, and co-localized with AtCBL1-OFP on the plasma membrane (Supplementary Fig. 7a). Consistently, ZmSnRK2.9-GFP and ZmSnRK2.10-GFP were co-localized with AtCBL1-OFP in the plasma membrane of onion epidermal cells under control conditions and after the induction of plasmolysis using 30% sucrose solution (Supplementary Fig. 7b), confirming that ZmSnRK2.9-GFP and ZmSnRK2.10-GFP are positioned where they can phosphorylate ZmHAK4, which localized in the plasma membrane.

Given that protein kinase often interacts with and phosphorylates the intracellular N-terminal and/or C-terminal domain of plasma membrane-localized ion transporters to regulate their activity^5,42, we next determined whether ZmSnRK2.9 and ZmSnRK2.10 physically interact with the intracellular domains of ZmHAK4, ZmHKT1;1 or ZmHKT1;2. To do so, the N-terminal and C-terminal domains of ZmHAK4, ZmHKT1;1 and ZmHKT1;2 were amplified and cloned into vector pGADT7, the full-length CDS of ZmSnRK2.9 and ZmSnRK2.10 were cloned into pGBKT7 (Supplementary Fig. 8a), and then yeast two-hybrid assays were performed. Subsequently, we found that ZmSnRK2.9 and ZmSnRK2.10 interacted only with the N-terminal domain of ZmHAK4 (Supplementary Fig. 8b; Fig. 3a).

**Fig. 3: ZmSnRK2.9 and ZmSnRK2.10 interact with the N-terminal of ZmHAK4.**

We next validated the interaction between ZmSnRK2s and ZmHAK4 using the pull-down and firefly luciferase complementation imaging (LCI) assays (Fig. 3b–d). First, the glutathione S-transferase (GST)-tagged ZmSnRK2.9 and ZmSnRK2.10 proteins were expressed and purified from Escherichia coli, followed by incubation with the N-terminal MBP-tagged ZmHAK4 (MBP-ZmHAK4^N). The results showed that MBP-ZmHAK4^N could be pulled down by ZmSnRK2.9 and ZmSnRK2.10 in vitro (Fig. 3b, c). Second, we performed an LCI assay in tobacco leaf cells and detected a strong luminescence signal in the cells co-expressing cLUC-ZmSnRK2.9 and nLUC-ZmHAK4^N or cLUC-ZmSnRK2.10 and nLUC-ZmHAK4^N, but not in the control cells (Fig. 3d). Collectively, the in vitro and in vivo data demonstrate that ZmSnRK2.9 and ZmSnRK2.10 interact with ZmHAK4, suggesting a possibility that ZmSnRK2.9 and ZmSnRK2.10 regulate Na⁺ transport by modulating the activity of ZmHAK4 through phosphorylation.

ZmSnRK2.9 and ZmSnRK2.10 phosphorylate ZmHAK4 and improve its Na⁺ transport activity

We next determined whether ZmSnRK2.9 and ZmSnRK2.10 can phosphorylate ZmHAK4 by performing in vitro kinase assays using MBP-tagged ZmSnRK2.9 and ZmSnRK2.10 proteins, with GST-tagged ZmHAK4^N as substrates. The results demonstrated that both ZmSnRK2.9 and ZmSnRK2.10 can phosphorylate ZmHAK4^N in vitro (Fig. 4a, b). SnRK2s have been reported to belong to a type of Ser/Thr protein kinase. Using the online platform MusiteDeep (https://www.musite.net/), we identified a serine residue (S5) in the N-terminal domain of ZmHAK4 that potentially serves as a phosphorylation site for ZmSnRK2.9 and ZmSnRK2.10 (Supplementary Fig. 9). To validate this predicted phosphorylation site, we mutated S5 of ZmHAK4^N to alanine (A), which simulated a non-phosphorylated form of ZmHAK4^N. The follow-up in vitro kinase assays indicated that GST-ZmHAK4^N(S5A) phosphorylation by ZmSnRK2.9 and ZmSnRK2.10 was completely abolished and significantly reduced, respectively (Fig. 4a, b). This finding confirms that S5 is an important phosphorylation site for ZmSnRK2.9 and ZmSnRK2.10 in ZmHAK4. Meanwhile, the observation that ZmSnRK2.10 can still phosphorylate GST-ZmHAK4^N(S5A) at lower level suggests that it may be capable to phosphorylating additional sites in ZmHAK4^N.

**Fig. 4: ZmSnRK2.9 and ZmSnRK2.10 phosphorylate ZmHAK4 then increase its Na⁺ transport activity.**

The above studies have shown that the kinase activity of ZmSnRK2.9 and ZmSnRK2.10 was activated by salt stress (Fig. 1j). We then determined whether ZmSnRK2.9-and ZmSnRK2.10-mediated phosphorylation of ZmHAK4 increases upon salt treatment by performing an in-gel kinase assay using ZmHAK4^N as substrates (Fig. 4c). The autoradiography results demonstrated that the kinase activity of ZmSnRK2.9 and ZmSnRK2.10 in wild-type plants was significantly activated upon salt treatment, suggesting that ZmSnRK2.9 and ZmSnRK2.10 can phosphorylate ZmHAK4^N, with salt stress serving as an activator for this process (Fig. 4c). On the contrary, the salt treatment-induced increase in the kinase activity was significantly attenuated in ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 as compared to the wild type (Fig. 4c). These results indicate that ZmSnRK2.9 and ZmSnRK2.10 increase the phosphorylation of ZmHAK4 under salt conditions.

We next assessed whether the phosphorylation of ZmHAK4 alters its Na⁺-transporting activity using a Na⁺-exclusion-deficient yeast strain (ant5) based assay¹⁷. The results showed that ant5 cells co-expressing ZmHAK4 with ZmSnRK2.9 or ZmSnRK2.10 displayed a salt-hypersensitive phenotype and accumulated more Na⁺ as compared to the ant5 cells expressing ZmHAK4 alone (Fig. 4d, e), suggesting that ZmSnRK2.9- and ZmSnRK2.10-mediated phosphorylation of ZmHAK4 increases its Na⁺ transport activity. In agreeing with this conclusion, we found that the ant5 cells expressing ZmHAK4^S5A grew better and accumulated less Na⁺ under salt stress conditions as compared with the ant5 cells expressing ZmHAK4 alone, and there were undetectable differences between the ant5 cells expressing ZmHAK4^S5A and those co-expressing ZmHAK4^S5A with ZmSnRK2.9 or ZmSnRK2.10 (Fig. 4d, e). Taken together, we suggest that, under salt stress conditions, ZmSnRK2.9 or ZmSnRK2.10 increase the Na⁺ transport activity of ZmHAK4 by phosphorylating its Ser5 residue.

ZmSnRK2.10 promotes shoot Na⁺ exclusion by regulating ZmHAK4 activity

We next studied whether ZmSnRK2.9, ZmSnRK2.10, and ZmHAK4 act on the same pathway to regulate shoot Na⁺ exclusion and salt tolerance. Given that ZmSnRK2.10^crispr but not ZmSnRK2.9^crispr showed defective shoot Na⁺ exclusion and was more sensitive to salt stress than wild type, our genetic study focused on the relationship between ZmSnRK2.10 and ZmHAK4. A double mutant ZmSnRK2.10^crispr-1 ZmHAK4^crispr-1 was obtained by crossing ZmSnRK2.10^crispr-1 with ZmHAK4^crispr-1. The follow-up assay observed that, while both ZmHAK4^crispr-1 and ZmSnRK2.10^crispr-1 were significantly smaller than the wild type under salt conditions, the double mutant ZmSnRK2.10^crispr-1 ZmHAK4^crispr-1 showed a salt-sensitive phenotype comparable with that of ZmSnRK2.10^crispr-1 (Fig. 5a, b), supporting the notion that ZmHAK4 act downstream of ZmSnRK2.10. We further analyzed the Na⁺ and K⁺ content in the wild type, ZmSnRK2.10^crispr-1, ZmHAK4^crispr-1 and ZmSnRK2.10^crispr-1 ZmHAK4^crispr-1. The results indicated that, while all genotypes tested showed a comparable content of shoot, root and xylem sap ion (Na⁺ and K⁺) under control conditions, all mutants had more shoot and xylem sap Na⁺, less root Na⁺, less shoot and xylem sap K⁺, and more root K⁺ as compared to the wild-type plants (Fig. 5c–i). More specifically, ZmHAK4^crispr-1 and ZmSnRK2.10^crispr-1 ZmHAK4^crispr-1 showed a comparable phenotype of Na⁺ and K⁺ content, and the phenotype is more remarkable than that of ZmSnRK2.10^crispr-1 (Fig. 5c–i), supporting the notion that ZmSnRK2.10 modulates Na⁺ transport through regulating ZmHAK4 activity. We also noticed that ZmSnRK2.10^crispr-1 showed a salt-sensitive phenotype more remarkable than ZmHAK4^crispr-1, but it has lower shoot Na⁺ than ZmHAK4^crispr-1, suggesting that there are additional salt-tolerant mechanisms act at the downstream of ZmSnRK2.10.

**Fig. 5: ZmSnRK2.10 and ZmHAK4 act in the same pathway to promote shoot Na⁺ exclusion.**

A 20-bp deletion decreases ZmSnRK2.10 transcription and increases the shoot Na⁺ content

The natural variation in shoot Na⁺ exclusion has been reported to be associated with the diversity of salt tolerance in maize¹⁷. The transcriptome sequence data of 162 maize inbred lines, randomly selected from the previously described natural maize population, revealed significant diversity in the transcript levels of ZmSnRK2.10 (Supplementary Data 1). To examine whether the diversity of ZmSnRK2.10 transcription is associated with the natural variation of shoot Na⁺ content under salt conditions, we conducted a ZmSnRK2.10 expression genome-wide association study (eGWAS) to identify SNPs significantly associated with the transcript levels of ZmSnRK2.10 (Supplementary Fig. 10; “Methods”). The peak SNP (Chr5_18910214) with a -log₁₀(P) value of 17.48 was located at the upstream of ZmSnRK2.10 (Supplementary Fig. 10a). Based on the significant SNP, the 162 maize inbred lines can be classified into two genotypes, with an adenine (C) and a thymine (T) were associated with a low and a high transcript level of ZmSnRK2.10, respectively (Supplementary Fig. 10b). Intriguingly, we also observed that the Chr5_18910214_C inbred lines displayed a significantly higher shoot Na⁺ content as compared to the Chr5_18910214_T lines under salt conditions (Supplementary Fig. 10c), suggesting likely that the functional variation of ZmSnRK2.10 is associated with the diversity of shoot Na⁺ exclusion.

To reveal the molecular basis underlying the functional variation in ZmSnRK2.10, we sequenced the DNA fragment flanking ZmSnRK2.10 in 105 randomly selected inbred lines, including the promoter region, the coding sequence (CDS), and the 3’ untranslated regions (UTRs), subsequently identified 37 SNP variants and 5 InDel variants (Supplementary Data 2). The association between these variants and ZmSnRK2.10 transcript levels was analyzed using Tassel 5.0 software and found that three variants (SNP-357, SNP-467 and Del-356) that were in complete LD showed the highest significant association (Fig. 6a). The 105 maize inbred lines were categorized into two haplotype groups (Hap1 and Hap2) according to the haplotype of SNP-357, SNP-467 and Del-356 (Fig. 6b). The Hap1 and Hap2 groups consisted of 31 and 74 inbred lines, respectively. The transcript levels of ZmSnRK2.10 in Hap1 plants were significantly higher than those of Hap2 plants under both control and salt conditions (Fig. 6c), while the shoot Na⁺ content of the salt-grown Hap1 plants was significantly lower than that of the Hap2 plants (Fig. 6d; Supplementary Data 3).

**Fig. 6: A 20-bp deletion is associated with a decrease of *ZmSnRK2.10* transcription and an increase of shoot Na⁺ content.**

Further analysis indicated that SNP-357, SNP-467 and Del-356 potentially changed the binding sites of various transcription factors (Supplementary Fig. 11). To identify the specific variant responsible for the natural variation of ZmSnRK2.10 transcription, we cloned the ZmSnRK2.10 promoter from the maize inbred lines Zheng58 (a Hap1 line) and E588 (a Hap2 line), and generated three mutant forms of the ZmSnRK2.10^E588 promoter that resemble the promoter of ZmSnRK2.10^Zheng58, with pZmSnRK2.10^E588(C/A) containing a C to A substitution, pZmSnRK2.10^E588(T/C) containing a T to C substitution, and pZmSnRK2.10^E588(+20bp) putting back the 20-bp deleted sequence (GACAATATAAAAAATAAATA) (see Methods, Supplementary Fig. 12). These promoters were tagged to GFP and their transcriptional activities were determined by analyzing the expression of GFP in tobacco mesophyll cells. The results demonstrated that pZmSnRK2.10^Zheng58 exhibited significantly higher activity than pZmSnRK2.10^E588 (Fig. 6e), whereas pZmSnRK2.10^E588(+20bp) but not pZmSnRK2.10^E588(C/A) and pZmSnRK2.10^E588(T/C) showed activity comparable to pZmSnRK2.10^Zheng58 (Fig. 6e). These results indicated that the 20-bp deletion (Del-356) in the ZmSnRK2.10 promoter decreased the transcript levels of ZmSnRK2.10.

Del-356 attenuates salt-induced phosphorylation of ZmHAK4

Given that salt stress increase the phosphorylation of ZmHAK4 by ZmSnRK2.9/10, we next determined whether the reduced transcript levels of ZmSnRK2.10 in the maize inbred lines carrying Del-356 attenuated this induction. To this end, we conducted an in-gel kinase assay for ZmSnRK2.9 and ZmSnRK2.10 using inbred line Zheng58 (without Del-356) and E588 (with Del-356), with ZmHAK4^N serving as a substrate. The result indicated that salt treatment significantly enhanced the phosphorylation of ZmHAK4^N in both lines; however the phosphorylation is significantly lower in E588 compared to Zheng58 (Fig. 6f). This supports the notion that Del-356 increases shoot Na⁺ content by diminishing salt-induced phosphorylation of ZmHAK4. In addition, we assessed the salt sensitivity of maize inbred lines with Del-356 (n = 30) against those without it (n = 30). The results revealed a significantly greater reduction in biomass under salt condition among lines carrying Del-356 compared to those lacking it (Supplementary Fig. 13). This observation indicates that Del-356 at least partially explains the variations in salt tolerance within natural maize populations. Additionally, we compared the expression levels of ZmHAK4 across various inbred lines with and without Del-356. While a previous study revealed a 12,586-bp insertion (termed InDel8128) that decreases the transcript levels of ZmHAK4¹⁷, our investigation found that Del-356 has an insignificant effect on transcript levels of ZmHAK4, regardless the presence or absence of InDel8128 (Supplementary Fig. 14). This finding rules out the possibility that Del-356 increases shoot Na⁺ content through regulating the transcript levels of ZmHAK4.

Taken together, we conclude that Del-356 reduces the transcript levels of ZmSnRK2.10, leading to decreased the salt-induced phosphorylation of the Na⁺ transporter ZmHAK4 Consequently, this results in increased shoot Na⁺ content and reduced salt tolerance. Therefore, the ZmSnRK2.10 allele without Del-356 is identified as the favorable (salt-tolerant) allele.

The favorable ZmSnRK2.10 allele promotes shoot Na⁺ exclusion

The favorable alleles of agronomically important genes provide valuable genetic resources for breeding new crop varieties¹³. To investigate whether the favorable allele of ZmSnRK2.10 improves the exclusion of Na⁺ from the shoot, we generated an F2 segregating population using Zheng58 and E588 as parental lines. These lines confer a salt-tolerant (without Del-356) and salt-sensitive (with Del-356) ZmSnRK2.10 allele respectively (Fig. 6g). Concurrently, it was observed that the shoot Na⁺ content in Zheng58 is significantly higher than that in E588 under salt conditions (Fig. 6h). The F2 seeds were randomly selected and planted under control and salt (100 mM NaCl) conditions. Two weeks later, the shoot tissues of individual plants were collected for genotyping and determination of shoot Na⁺ content. We found that the shoot Na⁺ content of the F2 individuals carrying the homozygous favorable ZmSnRK2.10 allele (ZmSnRK2.10^Zheng58) was significantly lower than that of the ZmSnRK2.10^E588 plants (Fig. 6i). Additionally, plants with the heterozygous Del-356 genotype (ZmSnRK2.10^Zheng58/E588) displayed an intermediate Na⁺ level, situated between those of ZmSnRK2.10^Zheng58 and ZmSnRK2.10^E588 (Fig. 6i). These results indicate that the favorable ZmSnRK2.10 allele promotes exclusion of Na⁺ from the shoot tissue under salt stress conditions, thereby providing a promising genetic resource for breeding salt-tolerant maize varieties.

Discussion

Salt tolerance is a complex and agriculturally important trait. The exclusion of Na⁺ from the shoot tissue underlies a core mechanism of crop salt tolerance³. Previous studies have shown that there was a large diversity of shoot Na⁺ exclusion within the natural crop population^13,17,43, and various QTLs that regulate shoot Na⁺ exclusion have been identified in various crops, with some of them have been successfully applied for the development of salt-tolerant crops^13,44. Our previous studies showed that there was a large diversity of shoot Na⁺ content and salt tolerance in the natural maize population, partially attributed to the functional variation of the classical HKT1 family Na⁺ transporters^7,14. Meanwhile, our previous study also revealed that ZmHAK4 was associated with the natural variation of Na⁺ exclusion from maize shoot under salt conditions, and showed that the favorable ZmHAK4 allele displayed a higher ZmHAK4 transcription and a lower shoot Na⁺ content¹⁷. In this study, we show that ZmSnRK2.10 and ZmSnRK2.9 promote salt tolerance by phosphorylating and activating ZmHAK4 (Figs. 3–6). We also reveal that the functional variation of ZmSnRK2.10 conferred natural variation of shoot Na⁺ exclusion. The ZmSnRK2.10 allele that confers a 20-bp deletion in its promoter displays a lower ZmSnRK2.10 transcript level and a higher shoot Na⁺ content, representing the unfavorable ZmSnRK2.10 allele (Fig. 6). Guiding by this knowledge, future breeding program could use the favorable alleles of ZmHAK4 and ZmSnRK2.10 to co-strengthen the transcription and post-transcriptional activation of ZmHAK4, thus advancing the development of salt-tolerant maize.

HAK family transporters existed in most plant species, with various of them (e.g. AtHAK5 and OsHAK1) conferring high-affinity K⁺ uptake activity and playing an important role in plant response to K⁺ starvation^45,46. Our previous study showed that ZmHAK4 is a high-affinity Na⁺ transporter, which promotes shoot Na⁺ exclusion and salt tolerance, likely by mediating the retrieval of Na⁺ from xylem sap in maize¹⁷. Soon after, another group reported that the homologous of ZmHAK4 protein from tomato (SIHAK20) also promoted shoot Na⁺ exclusion and salt tolerance⁴⁷. Moreover, OsHAK2 and OsHAK12 have also been shown to transport Na⁺ and promote salt tolerance by a mechanism similar to that of ZmHAK4^18,48. Together, these observations indicate that HAK family Na⁺ transporters likely confer a conservative salt-tolerant mechanism, that is, promoting the exclusion of Na⁺ from the shoot tissue. On the basis of this, here we have further addressed how the activity of HAK family Na⁺ transporters is regulated, by showing that the Na⁺ transport activity of ZmHAK4 is post-transcriptionally regulated by ZmSnRK2.9 and ZmSnRK2.10 (Fig. 4a–d), providing an important molecular understanding of crop response to salt stress. It remains an open question whether the ZmSnRK2.9/ZmSnRK2.10-ZmHAK4 regulatory module is conserved in other species.

The SnRK2 family protein kinases play an important role in various physiological processes, including growth, development, stomata movement, osmotic stress, and so on^19,20,29. The SnRK2s were classified into three clades based on their responsiveness to ABA: the kinase activity of clade I members is not induced by ABA, clade II shows limited induction, while clade III exhibits strong induction⁴⁹. In the ABA signaling pathway, a RAF-SnRK2 cascade effectively activates and amplifies ABA signaling. Upon ABA treatment, ABA triggers the inhibition of PP2C activity, then RAFs promptly activate clade III SnRK2s, which in turn activate more inactive SnRK2s through autophosphorylation^50,51,52. Meanwhile, the clade III SnRK2 kinases (e.g. Arabidopsis OST1) can also be activated through the ABA-independent pathway⁵³. Here, we show that ZmSnRK2.9 and ZmSnRK2.10 encode clade III SnRK2 members, and their kinase activity increases upon salt stress (Fig. 1j). Given that salt stress vastly increases the ABA level in maize⁸, it is highly possible that the salt-induced activation of ZmSnRK2.9 and ZmSnRK2.10 is dependent on the ABA signaling pathway.

Previous studies have shown that SnRK2s regulate different physiological processes by targeting different downstream targets^33,54,55,56. For instance, Arabidopsis OST1 (SnRK2.6) promotes the closure of stomata by phosphorylating and activating SLAC1 and RbohF^57,58, and it can also promote the cold response by phosphorylating BTF3 and BTF3L (BTF3-like), β-subunits of a nascent polypeptide-associated complex⁵⁹. Clade III SnRK2s regulate gene expression under osmotic stress conditions by phosphorylating transcription factors (e.g. AREB/ABF) in Arabidopsis^60,61,62. Several SnRK2s have also been shown to be involved in plant response to salt stress. Arabidopsis SnRK2.4 and SnRK2.10 participate in root growth and morphogenesis under salt stress conditions³³. TaSnRK2.9 improves wheat salt tolerance by regulating ROS homeostasis in vivo⁵⁴. The SnRK2s protein kinases OsSAPK8 and OsSAPK4 participate in rice response to salt stress^55,56. Here, we show that ZmSnRK2.9 and ZmSnRK2.10 are involved in the regulation of shoot Na⁺ exclusion (a core salt-tolerant process) by phosphorylating and activating the Na⁺ transporter ZmHAK4 (Fig. 4), providing an important molecular understanding of SnRK2-regulated crop salt tolerance. Meanwhile, our findings showed that the biomass of the salt-grown ZmHAK4^crispr-1 is higher than that of ZmSnRK2.10^crispr-1 and ZmSnRK2.10^crispr-1 ZmHAK4^crispr-1 (Fig. 5a, b), which appears to be inconsistent with our findings on shoot Na⁺ content. However, considering plant salt tolerance is a multifaceted trait involving various mechanisms such as Na⁺ transport regulation and compartmentalization, ROS scavenging, osmotic stress responses, and so on^1,2,3. We hypothesize that beyond regulating Na⁺ transport through targeting ZmHAK4, ZmSnRK2 may also promotes salt tolerance by modulating additional downstream targets involved in other aspects of salt tolerance (e.g. ROS scavenging, osmotic stress responses). This presents an interesting question merits further investigation in future studies.

In summary, this study shows that the ZmSnRK2.9/ZmSnRK2.10-ZmHAK4 module positively regulates maize salt tolerance. Under salt conditions, the activity of ZmSnRK2.9 and ZmSnRK2.10 increases, leading to the activation of its downstream target ZmHAK4 by phosphorylating its Ser5 site, which in turn promotes shoot Na⁺ exclusion and salt tolerance. This study also shows that a 20-bp deletion in the ZmSnRK2.10 promoter reduces its transcript level, leading to diversity of shoot Na⁺ exclusion under salt stress conditions (Fig. 7). These observations provide theoretical understanding and genetic resources for breeding salt-tolerant maize cultivars.

**Fig. 7: A proposed model of ZmSnRK2.10-mediated natural variation in salt tolerance in maize.**

Methods

Plant materials

The maize (Zea mays L.) transgenic plants used for the salt tolerance test were provided by the Center for Crop Functional Genomics and Molecular Breeding, CAU. The maize inbred line 32990700 was used for the transformation and was designed as the ‘wild type’ in the manuscript. The double mutant ZmSnRK2.9^crispr-1 ZmSnRK2.10^crispr-1 and ZmSnRK2.10^crispr-1 ZmHAK4^crispr-1 are obtained by crossing and separating homozygous. Gene expression-based genome-wide association study (eGWAS) was performed using the transcript level of ZmSnRK2.10 in 162 maize inbred lines, and for ZmSnRK2.10-based association analysis, 105 randomly selected maize inbred lines were used.

Plant growth and phenotype assay

The maize plants used for salt tolerance screen and salt stress assay were grown as follows. Nine seeds for each genotype were sown in a pot (17 × 21 cm) filing with uniformly mixed Pindstrup substrate (www.pindstrup.com) and the soil was watered to saturation with water and salt (100 mM NaCl) solution, respectively, as a control and salt treatment. After growing for 2-weeks in a greenhouse, the shoot and root tissues of six plants harvested in each pot were for subsequent measurement of ion concentration. Three replicates were performed for each measurement.

Measurement of ion content

The collected samples were dried for 48 h in a constant temperature incubator at 80 °C, then weighed and incinerated in a muffle furnace at 300 °C for 3 h and 575 °C for 5 h. Subsequently, the ash of each sample was dissolved in 10 ml 10% nitric acid, and then diluted at different multiples to determine the content of Na⁺, K⁺ and Cl⁻, respectively. The M420 basic single channel flame photometer (Sherwood) was used to measure Na⁺ and K⁺ content, and the 926S chloride analyzer (Sherwood) was used to measure Cl^- content.

Analyze the subcellular localization of protein

To analyze the subcellular localization of ZmSnRK2.9 and ZmSnRK2.10, we amplified the coding sequence of ZmSnRK2.9 and ZmSnRK2.10 from B73 cDNA and combined them with GFP in the pSuper1300 vector. Then, pSuper1300-ZmSnRK2.9-GFP, pSuper1300-ZmSnRK2.10-GFP, and pSuper1300-GFP were transformed together with pGPTVII-AtCBL1-OFP into maize protoplasts and incubated at 22 °C for 15 h. The fluorescence of GFP and OFP was observed by confocal microscopy (ZEISS710; Carl Zeiss) with exciting wavelengths of 488 and 561.

qRT-PCR assay

To examine the effect of salt treatment on ZmSnRK2.9 and ZmSnRK2.10 transcription levels, nine plants were grown in normal conditions for 7 days, and then treated with water or 100 mM NaCl solution for 24 h, the shoot and root tissues were collected and frozen in liquid nitrogen, and subsequently subjected to RNA extraction and qRT-PCR analyses. Three replicates were performed for each assay. The primers used in this assay are shown in Supplementary Data 4.

Protein extraction and immunoblot assay

For protein-related experiments, different transgenic plants were planted for 7 days followed by treated with water or 100 mM NaCl solution, and then samples (shoot and root tissues) were collected at a certain point in time after treatment as indicated in Fig. 1i. Total proteins were extracted using the protein extraction buffer as follows: 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM MgCl₂, 0.2% NP-40, 5 mM DTT, 1 mM PMSF and 1×protease inhibitor cocktail. The protein samples were added with 5×SDS loading buffer and incubated at 100 °C for 5 min. ZmSnRK2.9 and ZmSnRK2.10 proteins were detected with anti-SnRK2s (SnRK2,2, SnRK2,3, SnRK2.6; Agrisera; Cat#AS142783, 1:1000) by immunoblot analysis.

Luciferase complementation imaging (LCI) assay

To conduct to LCI assay⁶³, the CDS of ZmSnRK2.9 and ZmSnRK2.10 were amplified and cloned into the 35S-cLUC vector, the N-terminal of ZmHAK4 (1-24aa) was cloned into the 35S-nLUC vector. The combinations of vectors shown in Fig. 3d were co-transformed into Agrobacterium strain GV3101 and then infiltrated into N. benthamiana leaves. After expression for 72 h, the images were captured by CCD (1300B; Roper Scientific).

Yeast two-hybrid assay

To perform yeast two-hybrid assays of the interaction between ZmSnRK2.10 and ZmSnRK2.9 with the other proteins (ZmHKT1;1^N, ZmHKT1;1^C, ZmHKT1;2^N ZmHKT1;2^C, ZmHAK4^N, ZmHAK4^C), the pGADT7-ZmHKT1;1^N, pGADT7-ZmHKT1;1^C, pGADT7-ZmHKT1;2^N, pGADT7- ZmHKT1;2^C, pGADT7-ZmHAK4^N, pGADT7-ZmHAK4^C, pGBKT7-ZmSnRK2.9 and pGBKT7-ZmSnRK2.10 constructs were co-transformed into yeast strain AH109 as indicated combination. The empty pGADT7 and pGBKT7 vectors were used as negative controls. The transformed yeast cells were grown on SD-Trp-Leu medium for 3 days, and then the monoclonal yeast cells were grown on SD-Trp-Leu or SD-Trp-Leu-His-Ade selective media for another 3 days and photographed.

In vitro pull-down assay

For in vitro pull-down assays, 2 µg of purified recombinant bait proteins (GST-ZmSnRK2.9 and GST-ZmSnRK2.10) and 2 µg of prey proteins (MBP or MBP-ZmHAK4^N) were added to 1 ml of binding buffer containing 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1.2% glycerol, and 2.5% Triton X-100. After incubation for 2 h at 4 °C, Glutathione Sepharose 4B beads (GE Healthcare; Cat#F042) were added and incubated for another 2 h, and then washed with the washing buffer I (50 mM Tris-HCl, pH 7.5, 150 mM NaCl), washing buffer II (50 mM Tris-HCl, pH 7.5, 200 mM NaCl), washing buffer III (50 mM Tris-HCl, pH 7.5, 300 mM NaCl) for six times (twice for each). The pulled-down proteins were eluted with 5×SDS loading buffer at 100 °C for 5 min, separated on 12% SDS-PAGE gels, and detected by immunoblotting with anti-MBP antibodies (Abclonal; Cat#AE016, 1:5000) or anti-GST antibodies (Abclonal; Cat#AE001, 1:5000).

In vitro phosphorylation assay

To conduct the in vitro phosphorylation assay⁶⁴, 1 μg recombinant proteins MBP-ZmSnRK2.10 and 10 μg GST-ZmHAK4^N or GST-ZmHAK4^N(S5A) were incubated in kinase reaction buffer (20 mM Tri-HCl pH 7.5, 0.5 mM CaCl₂, 2.5 mM MnCl₂, 2.5 mM MgCl₂, 1 mM DTT, 100 μM ATP) at 30 °C for 30 min with 1μCi [γ-³²P] ATP. After the reactions were terminated by incubation with 5×SDS protein loading buffer for 5 min at 100 °C, the proteins were separated by 12% SDS-PAGE, and radioactivity was detected using a Typhoon 9410 scanner.

In-gel kinase assay

To conduct the In-gel kinase assays⁶⁵, total proteins were extracted from 7-day-old seedlings (salt-treated for 0 and 2 h) with protein extraction buffer containing 5 mM EDTA pH 8.0, 5 mM EGTA pH 8.0, 25 mM NaF, 1 mM Na₃VO₄, 20% (v/v) glycerol, 2 mM DTT, 1×protease inhibitor cocktail (Roche) and 25 mM HEPES-KOH pH 7.5. The proteins were separated on a 10% (v/v) SDS-PAGE gel containing 0.3 mg/ml GST-ZmHAK4^N or 0.1 mg/ml MyBP substrate (Sigma-Aldrich; Cat#13-104). The gel was then washed three times with washing buffer (25 mM Tris-HCl pH 7.5, 0.5 mM DTT, 5 mM NaF, 0.1 mM Na₃VO₄, 0.5 mg/ml BSA and 0.1% [v/v] Triton X-100) at room temperature for 20 min each. The gel was incubated in renatured buffer containing 25 mM Tris-HCl pH 7.5, 1 mM DTT, 5 mM NaF, and 0.1 mM Na₃VO₄ at 4 °C for 1 h, 12 h, and 1 h, respectively. After incubation of the gel in the kinase reaction buffer (40 mM HEPES-KOH pH 7.5, 1 mM DTT, 12 mM MgCl₂, 0.1 mM Na₃VO₄, and 2 mM EGTA) at room temperature for 30 min, it will be incubated in new kinase reaction buffer supplemented with 70 μCi [γ-³²P] ATP and 9 μl 1 mM cold ATP at room temperature for 2 h and then washed with 5% (w/v) TCA and 1% (w/v) sodium pyrophosphate for five times (30 min for each). Radioactivity was detected using Typhoon 9410 imager.

ZmSnRK2.10-based association analysis

For the ZmSnRK2.10-based association analysis, 105 inbred lines were randomly selected from the population used for the eGWAS assay, and then their genomic fragment, including the promoter, the CDS and the 3’UTR of ZmSnRK2.10, was amplified and sequenced. Using BIOEDIT to align the multiple sequence and polymorphic sites (SNPs and InDels) with MAF ≥ 0.05 were identified. The associations between genetic variation and the transcript levels of ZmSnRK2.10 were determined using TASSEL 5.0 under the standard MLM⁶⁶. The primers used in this assay are shown in Supplementary Data 4.

Analysis of ZmHAK4 activity

The yeast transformation and Na⁺ content measurement of yeast were performed as previously described¹⁷. The coding sequences of ZmHAK4 were cloned into the p416-GPD vector, the coding sequences of ZmSnRK2.9, ZmSnRK2.10 were cloned into the pGBKT7 vector, and then the vectors with the indicated combinations were co-transformed into the yeast strain ant5. The transformed yeast cells were cultured overnight at 30 °C in YPDA medium until the OD₆₀₀ = 0.8, and then yeast cells were collected and washed three times with deionized water, 10 fold serial diluted cultures were then made and were incubated on AP plates containing varying concentrations of NaCl⁴². To determine the intracellular cation content, ant5 cells transformed with the indicated vectors were grown in liquid AP medium supplemented with 3 mM KCl for 12 h, washed twice with autoclaved deionized water, inoculated in AP medium for 4 h, and washed three times with deionized water, then inoculated in AP medium supplemented with 20 mM NaCl for indicated time shown in Fig. 4e. The yeast cells were then used to measure intracellular cation content, as outlined in the preceding section titled “Measurement of Ion Content”.

Statistics and reproducibility

In this study, statistical analyses and data visualization were conducted using Microsoft Excel or GraphPad Prism (version 10.1.2). For comparisons between two groups, statistical significance was assessed using two-sided Student’s t-tests. Multiple group comparisons were evaluated via one-way ANOVA followed by Fisher’s Least Significant Difference (LSD) post-hoc test. The exact P values are presented either in the figures or in Supplementary Data 5. Western blot analyses were performed using comparative samples obtained from the same experiment and processed concurrently. Unless otherwise stated, all experiments were biologically replicated at least three times, yielding consistent results.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

This study includes no data deposited in external repositories. The gene and amino acid sequences analyzed in this study were obtained from the following public databases: Maize GDB for maize (https://www.maizegdb.org/), Gramene for rice (http://ensembl.gramene.org/index.html) and TAIR10 for Arabidopsis (https://www.arabidopsis.org/). All supporting data are included in the main text or the supplementary information files. A detailed reporting summary and Source data are provided with this paper.

References

Zhu, J. K. Abiotic stress signaling and responses in plants. Cell 167, 313–324 (2016).
Article CAS PubMed PubMed Central Google Scholar
Melino, V. & Tester, M. Salt-tolerant crops: time to deliver. Annu. Rev. Plant Biol. 74, 671–696 (2023).
Article CAS PubMed Google Scholar
Munns, R. & Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 59, 651–681 (2008).
Article CAS PubMed Google Scholar
Du, F. P. et al. The basic helix-loop-helix transcription factor gene, OsbHLH38, plays a key role in controlling rice salt tolerance. J. Integr. Plant Biol. 65, 1859–1873 (2023).
Article CAS PubMed Google Scholar
Yang, Y. Q. & Guo, Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. N. Phytol. 217, 523–539 (2018a).
Article CAS Google Scholar
Steinhorst, L. et al. A Ca²⁺-sensor switch for tolerance to elevated salt stress in Arabidopsis. Dev. Cell 57, 2081–2094 (2022).
Article CAS PubMed Google Scholar
Zhang, M. et al. A teosinte-derived allele of an HKT1 family sodium transporter improves salt tolerance in maize. Plant Biotechnol. J. 21, 97–108 (2023).
Article PubMed Google Scholar
van Zelm, E. et al. Salt tolerance mechanisms of plants. Annu. Rev. Plant Biol. 71, 403–433 (2020).
Article PubMed Google Scholar
Geilfus, C. M. et al. Early response to salt ions in maize (Zea mays L.). J. Plant Physiol. 220, 173–180 (2018).
Article CAS PubMed Google Scholar
Deinlein, U. et al. Plant salt-tolerance mechanisms. Trends Plant Sci. 19, 371–379 (2014).
Article CAS PubMed PubMed Central Google Scholar
Yang, Y. Q. & Guo, Y. Unraveling salt stress signaling in plants. J. Integr. Plant Biol. 60, 796–804 (2018b).
Article CAS PubMed Google Scholar
Ren, Z. H. et al. A rice quantitative trait locus for salt tolerance encodes a sodium transporter. Nat. Genet. 37, 1141–1146 (2005).
Article CAS PubMed Google Scholar
Munns, R. et al. Wheat grain yield on saline soils is improved by an ancestral Na⁺ transporter gene. Nat. Biotechnol. 30, 360–364 (2012).
Article CAS PubMed Google Scholar
Zhang, M. et al. A retrotransposon in an HKT1 family sodium transporter causes variation of leaf Na⁺ exclusion and salt tolerance in maize. N. Phytol. 217, 1161–1176 (2018).
Article CAS Google Scholar
Chu, M. L. et al. The Arabidopsis phosphatase PP2C49 negatively regulates salt tolerance through inhibition of AtHKT1;1. J. Integr. Plant Biol. 63, 528–542 (2021).
Article CAS PubMed Google Scholar
Liu, Y. T. et al. Plasma membrane-localized Hsp40/DNAJ chaperone protein facilitates OsSUVH7-OsBAG4-OsMYB106 transcriptional complex formation for OsHKT1;5 activation. J. Integr. Plant Biol. 65, 265–279 (2023).
Article CAS PubMed Google Scholar
Zhang, M. et al. A HAK family Na⁺ transporter confers natural variation of salt tolerance in maize. Nat. Plants 5, 1297–1308 (2019).
Article CAS PubMed Google Scholar
Zhang, L. et al. Rice Na⁺-permeable transporter OsHAK12 mediates shoots Na⁺ exclusion in response to salt stress. Front. Plant Sci. 12, 771746 (2021).
Article PubMed PubMed Central Google Scholar
Shinozawa, A. et al. SnRK2 protein kinases represent an ancient system in plants for adaptation to a terrestrial environment. Commun. Biol. 2, 30 (2019).
Article PubMed PubMed Central Google Scholar
Halford, N. G. & Hey, S. J. Snf1-related protein kinases (SnRKs) act within an intricate network that links metabolic and stress signalling in plants. Biochem. J. 419, 247–259 (2009).
Article CAS PubMed Google Scholar
Anderberg, R. J. & Walker-Simmons, M. K. Isolation of a wheat cDNA clone for an abscisic acid-inducible transcript with homology to protein kinases. Proc. Natl Acad. Sci. USA 21, 10183–10187 (1992).
Article Google Scholar
Hanks, S. K. et al. The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241, 42–52 (1988).
Article ADS CAS PubMed Google Scholar
Ying, S. et al. Cloning and characterization of a maize SnRK2 protein kinase gene confers enhanced salt tolerance in transgenic Arabidopsis. Plant Cell Rep. 30, 1683–1699 (2011).
Article CAS PubMed Google Scholar
Zhang, H. et al. Differential activation of the wheat SnRK2 family by abiotic stresses. Front. Plant Sci. 7, 420 (2016).
PubMed Central Google Scholar
Lei, L. et al. Phosphorylation of the pseudomonas effector AvrPtoB by Arabidopsis SnRK2.8 is required for Bacterial Virulence. Mol. Plant. 13, 1513–1522 (2020).
Article CAS PubMed Google Scholar
Hsu, P. K. et al. Signaling mechanisms in abscisic acid-mediated stomatal closure. Plant J. 105, 307–321 (2021).
Article CAS PubMed Google Scholar
Wei, W. et al. Zinc-finger protein GmZF351 improves both salt and drought stress tolerance in soybean. J. Integr. Plant Biol. 65, 1636–1650 (2023).
Article CAS PubMed Google Scholar
Merlot, S. et al. Use of infrared thermal imaging to isolate Arabidopsis mutants defective in stomatal regulation. Plant J. 30, 601–609 (2002).
Article CAS PubMed Google Scholar
Mustilli, A. C. et al. Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. Plant Cell 14, 3089–3099 (2002).
Article CAS PubMed PubMed Central Google Scholar
Geiger, D. et al. Guard cell anion channel SLAC1 is regulated by CDPK protein kinases with distinct Ca²⁺ affinities. Proc. Natl Acad. Sci. USA 107, 8023–8028 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Imes, D. et al. Open stomata 1 (OST1) kinase controls R-type anion channel QUAC1 in Arabidopsis guard cells. Plant J. 74, 372–382 (2013).
Article CAS PubMed Google Scholar
Chen, X. X. et al. Protein kinases in plant responses to drought, salt, and cold stress. J. Integr. Plant Biol. 63, 53–78 (2021).
Article CAS PubMed Google Scholar
McLoughlin, F. et al. The Snf1-related protein kinases SnRK2.4 and SnRK2.10 are involved in maintenance of root system architecture during salt stress. Plant J. 72, 436–449 (2012).
Article CAS PubMed PubMed Central Google Scholar
Boudsocq, M. et al. Osmotic signaling in plants: multiple pathways mediated by emerging kinase families. Plant Physiol. 138, 1185–1194 (2005).
Article CAS PubMed PubMed Central Google Scholar
Kumar, S. et al. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874 (2016).
Article CAS PubMed PubMed Central Google Scholar
Huai, J. et al. Cloning and characterization of the SnRK2 gene family from Zea mays. Plant Cell Rep. 27, 1861–1868 (2008).
Article CAS PubMed Google Scholar
Ali, A. et al. Rheostatic control of ABA signaling through HOS15-mediated OST1 degradation. Mol. Plant. 12, 1447–1462 (2019).
Article CAS PubMed Google Scholar
Yin, P. et al. Cytokinin signaling promotes salt tolerance by modulating shoot chloride exclusion in maize. Mol. Plant 16, 1031–1047 (2023).
Article CAS PubMed Google Scholar
Ren, Z. J. et al. A chloride efflux transporter, BIG RICE GRAIN 1, is involved in mediating grain size and salt tolerance in rice. J. Integr. Plant Biol. 63, 2150–2163 (2021).
Article CAS PubMed Google Scholar
Cao, Y. B. et al. A domestication-associated reduction in K⁺-preferring HKT transporter activity underlies maize shoot K⁺ accumulation and salt tolerance. N. Phytol. 222, 301–317 (2019).
Article CAS Google Scholar
Li, J. et al. The Os-AKT1 channel is critical for K⁺ uptake in rice roots and is modulated by the rice CBL1-CIPK23 complex. Plant Cell 26, 3387–3402 (2014).
Article ADS CAS PubMed PubMed Central Google Scholar
Zhou, X. Y. et al. The classical SOS pathway confers natural variation of salt tolerance in maize. N. Phytol. 236, 479–494 (2022).
Article CAS Google Scholar
Baxter, I. et al. A coastal cline in sodium accumulation in Arabidopsis thaliana is driven by natural variation of the sodium transporter AtHKT1;1. PLoS Genet. 6, e1001193 (2010).
Article PubMed PubMed Central Google Scholar
Henderson, S. W. et al. Functional differences in transport properties of natural HKT1;1 variants influence shoot Na⁺ exclusion in grapevine rootstocks. N. Phytol. 217, 1113–1127 (2018).
Article CAS Google Scholar
Chen, G. et al. Rice potassium transporter OsHAK1 is essential for maintaining potassium-mediated growth and functions in salt tolerance over low and high potassium concentration ranges. Plant Cell Environ. 38, 2747–2765 (2015).
Article CAS PubMed Google Scholar
Zhao, S. et al. Phosphorylation of ARF2 relieves its repression of transcription of the K⁺ transporter gene HAK5 in response to low potassium stress. Plant Cell 28, 3005–3019 (2016).
Article CAS PubMed PubMed Central Google Scholar
Wang, Z. et al. Loss of salt tolerance during tomato domestication conferred by variation in a Na⁺ /K⁺ transporter. EMBO J. 39, e103256 (2020).
Article CAS PubMed PubMed Central Google Scholar
Morita, S. et al. In planta evidence that the HAK transporter OsHAK2 is involved in Na+ transport in rice. Biosci. Biotechnol. Biochem. 87, 482–490 (2023).
Article PubMed Google Scholar
Ng, L. M. et al. Abscisic acid perception and signaling: structural mechanisms and applications. Acta Pharmacol. Sin. 35, 567–584 (2014).
Fàbregas, N. et al. Role of Raf-like kinases in SnRK2 activation and osmotic stress response in plants. Nat. Commun. 11, 6184 (2020).
Article ADS PubMed PubMed Central Google Scholar
Lin, Z. et al. Initiation and amplification of SnRK2 activation in abscisic acid signaling. Nat. Commun. 12, 2456 (2021).
Article ADS CAS PubMed PubMed Central Google Scholar
Fujii, H. et al. In vitro reconstitution of an abscisic acid signalling pathway. Nature 462, 660–664 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Ding, Y. L. et al. EGR2 phosphatase regulates OST1 kinase activity and freezing tolerance in Arabidopsis. EMBO J. 38, e99819 (2019).
Article PubMed Google Scholar
Feng, J. et al. TaSnRK2.9, a sucrose non-fermenting 1-related protein kinase gene, positively regulates plant response to drought and salt stress in transgenic tobacco. Front. Plant Sci. 9, 2003 (2019).
Article PubMed PubMed Central Google Scholar
Zhong, R. et al. Rice SnRK protein kinase OsSAPK8 acts as a positive regulator in abiotic stress responses. Plant Sci. 292, 110373 (2020).
Article CAS PubMed Google Scholar
Diédhiou, C. J. et al. The SNF1-type serine-threonine protein kinase SAPK4 regulates stress-responsive gene expression in rice. BMC Plant Biol. 8, 49 (2008).
Article PubMed PubMed Central Google Scholar
Geiger, D. et al. Activity of guard cell anion channel SLAC1 is controlled by drought-stress signaling kinase-phosphatase pair. Proc. Natl Acad. Sci. USA 106, 21425–21430 (2009).
Article ADS CAS PubMed PubMed Central Google Scholar
Sirichandra, C. et al. Phosphorylation of the Arabidopsis AtrbohF NADPH oxidase by OST1 protein kinase. FEBS Lett. 583, 2982–2986 (2009).
Article CAS PubMed Google Scholar
Ding, Y. L. et al. OST1-mediated BTF3L phosphorylation positively regulates CBFs during plant cold responses. EMBO J. 37, e98228 (2018).
Article PubMed PubMed Central Google Scholar
Kang, J. Y. et al. Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell 14, 343–357 (2002).
Article CAS PubMed PubMed Central Google Scholar
Fujita, Y. et al. AREB1 is a transcription activator of novel ABRE-dependent ABA signaling that enhances drought stress tolerance in Arabidopsis. Plant Cell 17, 3470–3488 (2005).
Article CAS PubMed PubMed Central Google Scholar
Fujita, Y. et al. Three SnRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. Plant Cell Physiol. 50, 2123–2132 (2009).
Article CAS PubMed Google Scholar
Chen, H. et al. Firefly luciferase complementation imaging assay for protein-protein interactions in plants. Plant Physiol. 146, 368–376 (2008).
Article ADS CAS PubMed PubMed Central Google Scholar
Xiao, H. X. et al. Nitrate availability controls translocation of the transcription factor NAC075 for cell-type-specific reprogramming of root growth. Dev. Cell 57, 2638–2651 (2022).
Article CAS PubMed Google Scholar
Ding, Y. L. et al. OST1 kinase modulates freezing tolerance by enhancing ICE1 stability in Arabidopsis. Dev. Cell 32, 278–289 (2015).
Article CAS PubMed Google Scholar
Bradbury, P. J. et al. TASSEL: software for association mapping of complex traits in diverse samples. Bioinformatics 23, 2633–2635 (2007).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

The authors acknowledge financial support from the National Science Fund for Distinguished Young Scholars (32325037 to C.J.), the National Key R&D Program of China (2022YFF1001601 to C.J.), the China Postdoctoral Science Foundation (GZB20240201 and 2024M760789 to M.Z.), the Natural Science Foundation of He’nan Province (252300421149 to M.Z.), the National Natural Science Foundation of China (Grant U2106229 to C.J., 32301758 to X.Z.), and Pinduoduo–China Agricultural University Research Fund (PC2023A02004 to C.J.).

Author information

These authors contributed equally: Ming Zhang, Xueyan Zhou, Limin Wang.

Authors and Affiliations

State Key Laboratory of Plant Environmental Resilience, College of Biological Sciences, China Agricultural University, Beijing, China
Ming Zhang, Xueyan Zhou, Limin Wang, Xiaoyan Liang & Caifu Jiang
The Zhongzhou Laboratory for Integrative Biology, Henan University, Zhengzhou, Henan, China
Ming Zhang
State Key Laboratory of Crop Stress Adaptation and Improvement, College of Life Sciences, Academy for Advanced Interdisciplinary Studies, Henan University, Kaifeng, Henan, China
Ming Zhang
Key Lab of Plant Biotechnology in University of Shandong Province, College of Life Science, Qingdao Agricultural University, Qingdao, China
Xin Liu
Center for Crop Functional Genomics and Molecular Breeding, China Agricultural University, Beijing, China
Caifu Jiang
Frontiers Science Center for Molecular Design Breeding, Beijing, China
Caifu Jiang

Authors

Ming Zhang
View author publications
Search author on:PubMed Google Scholar
Xueyan Zhou
View author publications
Search author on:PubMed Google Scholar
Limin Wang
View author publications
Search author on:PubMed Google Scholar
Xiaoyan Liang
View author publications
Search author on:PubMed Google Scholar
Xin Liu
View author publications
Search author on:PubMed Google Scholar
Caifu Jiang
View author publications
Search author on:PubMed Google Scholar

Contributions

M.Z., X.Z., L.W., XY.L., X.L., and C.J. planned and designed the research. M.Z., X.Z., and L.W. screened the mutant population and measured the ion contents. M.Z. and X.Z. generated the CRISPR/Cas9 knockout lines. M.Z., X.Z., and L.W. carried out the functional analysis. M.Z. and C.J. wrote the manuscript (the other authors contributed).

Corresponding authors

Correspondence to Ming Zhang or Caifu Jiang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Communications thanks Teruaki Taji, and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data

Reporting Summary

Transparent Peer Review file

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Cite this article

Zhang, M., Zhou, X., Wang, L. et al. A SnRK2-HAK regulatory module confers natural variation of salt tolerance in maize. Nat Commun 16, 4026 (2025). https://doi.org/10.1038/s41467-025-59332-x

Download citation

Received: 01 December 2023
Accepted: 16 April 2025
Published: 29 April 2025
DOI: https://doi.org/10.1038/s41467-025-59332-x