Dynamic regulation of integrin β1 phosphorylation supports invasion of breast cancer cells

Conway, James R. W.; Joshi, Omkar; Kaivola, Jasmin; Follain, Gautier; Gounis, Michalis; Kühl, David; Ivaska, Johanna

doi:10.1038/s41556-025-01663-4

Download PDF

Article
Open access
Published: 26 May 2025

Dynamic regulation of integrin β1 phosphorylation supports invasion of breast cancer cells

Nature Cell Biology volume 27, pages 1021–1034 (2025)Cite this article

14k Accesses
87 Altmetric
Metrics details

Subjects

Abstract

Integrins provide an essential bridge between cancer cells and the extracellular matrix, playing a central role in every stage of disease progression. Despite the recognized importance of integrin phosphorylation in several biological processes, the regulatory mechanisms and their relevance remained elusive. Here we engineer a fluorescence resonance energy transfer biosensor for integrin β1 phosphorylation, screening 96 protein tyrosine phosphatases and identifying Shp2 and PTP-PEST as negative regulators to address this gap. Mutation of the integrin NPxY(783/795) sites revealed the importance of integrin phosphorylation for efficient cancer cell invasion, further supported by inhibition of the identified integrin phosphorylation regulators Shp2 and Src kinase. Using proteomics approaches, we uncovered Cofilin as a component of the phosphorylated integrin-Dok1 complex and linked this axis to effective invadopodia formation, a process supporting breast cancer invasion. These data further implicate dynamic modulation of integrin β1 phosphorylation at NPxY sites at different stages of metastatic dissemination.

Understanding the role of integrins in breast cancer invasion, metastasis, angiogenesis, and drug resistance

Article 08 January 2021

TC10 regulates breast cancer invasion and metastasis by controlling membrane type-1 matrix metalloproteinase at invadopodia

Article Open access 16 September 2021

An autophagy-inducing stapled peptide induces mitochondria dysfunction and triggers autotic cell death in triple-negative breast cancer

Article Open access 19 August 2023

Main

Cellular adhesion to the extracellular matrix (ECM) is an essential prerequisite for multicellular organisms. Remodelling of this scaffold supports resistance to extracellular stresses and provides a reproducible environment to guide tissue functions. Thus, cell-ECM interactions are vital and are mediated by integrin adhesion receptors. Integrins form a diverse family, with 24 heterodimers arising from 18 α and 8 β subunit pairings¹. Central to this family is integrin β1, which accounts for half of αβ receptors and exclusively mediates binding to several ECM components. Given this vital role in cell–ECM interactions, it is unsurprising that loss of integrin β1 is early embryonic lethal^2,3. Similarly, two conserved tyrosine-motifs (NPxY) in the cytoplasmic domain are essential for integrin β1 function. Mutation to NPxA (YYAA) renders the receptor inactive and unstable, resulting in embryonic lethality, whereas the non-phosphorylatable NPxF (YYFF) mutation shows a milder phenotype^4,5,6 (Fig. 1a). In a cancer setting, however, YYFF mutation reduces baseline signal transduction^7,8 and FAK activation and delays tumourigenesis⁹. Together, these data highlight the importance of the NPxY sites and integrin phosphorylation for receptor functionality.

**Fig. 1: ITGB1 phosphorylation supports efficient cancer cell invasion.**

Despite this established link to tumour initiation and growth, the role of integrin phosphorylation in cancer invasion has not been investigated. Furthermore, the molecular components recruited to the phosphorylated integrin are largely unknown, and the same is true for the regulatory kinases and phosphatases. This is due to a lack of tools to interrogate integrin β1 phosphorylation, which previously relied solely on suboptimal phospho-specific antibodies and mutagenesis. Early work in Rous-sarcoma virus transformed fibroblasts showed phosphorylated integrin β1 peptide localization in podosomes¹⁰ but only hinted at the involvement of the Src family kinases in integrin phosphorylation. Later, integrin phosphorylation was demonstrated as a conserved mechanism regulating the recruitment of cytoplasmic components to the receptor. The best characterized of these components is Dok1, the only known adaptor protein to preferentially bind phosphorylated integrin β1 (ref. ¹¹). By contrast, the non-phosphorylated receptor supports binding of talin, and while there is a well-established recruitment of proteins to talin through a stepwise process of ECM adhesion maturation and linkage to the actin cytoskeleton^12,13, the role and components of the phosphorylated integrin β1/Dok1 complex were unknown. In this work, we uncover a regulatory network of kinases and protein tyrosine phosphatases (PTPs) that dynamically recruit a phosphorylation-sensitive protein complex to mediate efficient cancer cell invasion.

Results

Integrin phosphorylation directs breast cancer cell invasion

To model integrin β1 (hereafter referred to as ITGB1) phosphorylation during invasive breast cancer progression, we knocked down the ITGB1 mRNA in MDA-MB-231 (MM231) breast cancer cells using a lentiviral short-hairpin RNA (shRNA) (MM231 shβ1 cells; Extended Data Fig. 1a). We then reexpressed mRuby2-tagged ITGB1 wild-type (WT) or a variant with the cytoplasmic NPxY sites mutated to NPxF (that is, Y783F and Y795F, referred to as YYFF hereafter) (Fig. 1a) to mimic loss of ITGB1 phosphorylation at these sites. These integrin-reexpressing shβ1 MM231 cells are used throughout the study and are referred to as MM231 ITGB1(WT or YYFF). Of note, these cell lines showed no proliferative defects (Extended Data Fig. 1b,c). They also had comparable ITGB1 cell-surface levels, with no compensatory upregulation of integrin β3, as found in some cell line models^14,15 (Extended Data Fig. 1e and quantified in Extended Data Fig. 1f). Similarly, there were no significant differences in integrin activation state nor the size and number of integrin adhesion complexes (IACs) (Extended Data Fig. 1g and quantified in Extended Data Fig. 1h,i). However, MM231 ITGB1(YYFF) cell invasion into a fibroblast-contracted three-dimensional (3D) collagen matrix¹⁶ was significantly reduced (Fig. 1b,c), without impacting cell proliferation (Ki67 staining and ratio of negative-to-positive nuclei) (Extended Data Fig. 1j). In line with this invasion defect, we observed decreased cell spreading in 3D with ITGB1-knockdown (KD) MM231s (shβ1) and MM231 ITGB1(YYFF) cells, compared with parental cells (Fig. 1d). To assess the role of ITGB1 phosphorylation on local invasion in vivo, we subcutaneously xenografted MM231 ITGB1(WT or YYFF) cells and detected a significant reduction in MM231 ITGB1(YYFF) cell invasion into the subcutaneous fat and muscle (Fig. 1e), while again observing no significant effect on proliferation (Ki67 staining) (Extended Data Fig. 1k). Cumulatively, these data demonstrate the importance of the ITGB1 NPxY sites as essential mediators of effective breast cancer invasion.

Generation of the first integrin phosphorylation reporter

The regulators of integrin phosphorylation are primarily unknown, largely owing to a lack of effective tools to interrogate phosphorylation in intact cells. Yet, we see that loss of ITGB1 phosphorylation at the NPxY sites has a profound effect on breast cancer invasion (Fig. 1), emphasizing the importance of this poorly understood aspect of integrin biology. To address this mechanistic gap, we developed a fluorescent reporter for ITGB1 phosphorylation based on the established models for substrate-based fluorescence resonance energy transfer (FRET) reporters for Src and other kinases^17,18. The ITGB1 phosphorylation FRET reporter (hereafter referred to as ‘Illusia’, inspired by Finnish mythology¹⁹) relies upon a conformational change that occurs through an interaction between two domains of the reporter, the phosphotyrosine (pY) binding domain (PTB) from Dok1 and the C-terminal amino acids from ITGB1 (Fig. 2a). The interaction is mediated by phosphorylation of the ITGB1 NPxY sites, included in Illusia, which pulls apart the donor (mTurquoise2) and acceptor (YPet) FRET pair, a conformational change detected by a decrease in FRET efficiency and a corresponding increase in the fluorescence lifetime of the donor. Illusia supports live assessment of the kinase/phosphatase balance in the cell. However, it is important to note that Illusia reflects the phosphorylation status of the integrin tail motif (as a freely diffusing, membrane-tethered ITGB1 tail-like substrate), rather than directly reporting ITGB1 phosphorylation.

**Fig. 2: Src is a regulatory kinase for the ITGB1 NPxY motifs.**

To ensure that the phosphorylation-dependent binding of the Dok1 PTB would be reversible, we assessed the effect of Dok1 overexpression on ITGB1 and found no increase in phosphorylation on the membrane-proximal tyrosine, suggesting that Dok1 does not play a protective role for the phosphorylation (Extended Data Fig. 2a). Similarly, we validated the phosphorylation-dependent binding of Dok1 in cellulo using an intermolecular FRET assay between the mRuby2-tagged ITGB1 WT and YYFF mutant receptors (Extended Data Fig. 2b). This confirmed that the interaction between ITGB1 and Dok1 was significantly reduced in the absence of phosphorylation in MM231 ITGB1(YYFF) cells (Extended Data Fig. 2c). Notably, the reverse was observed for a talin-1 head domain fragment (F₀–F₃ from mouse Tln1), which showed an increased interaction with the non-phosphorylatable YYFF receptor (Extended Data Fig. 2d) and is in line with talin-1 having a reduced affinity for phosphorylated integrins β1 and β3 (ref. ¹¹).

Illusia demonstrates direct Src phosphorylation of ITGB1

While earlier reports have implied Src phosphorylation of integrins^20,21, Abl2/Arg (Abl-related gene) is the only tyrosine kinase that has been shown to directly phosphorylate ITGB1 on the membrane-proximal NPxY(783) site²². Thus, initial validation of Illusia was performed through overexpression of the non-receptor tyrosine kinase Arg. Here, overexpression of the WT but not the kinase-dead mutant (K281M) Arg significantly reduced Illusia FRET, indicating a phosphorylation-sensitive change in the reporter conformation (Extended Data Fig. 2f and quantified in Extended Data Fig. 2e). The parallel western blots confirmed that this change occurred in conjunction with an increase in ITGB1 phosphorylation on the NPxY(783) site (Extended Data Fig. 2g and quantified in Extended Data Fig. 2h). It has also been suggested that the cytoplasmic domain of ITGB1 is a substrate for Src kinase^20,21, with similar work demonstrating that Src phosphorylation of integrin β3 reduces receptor engagement with fibronectin²³. Accordingly, we explored this link in cells using the Illusia FRET reporter, inducing expression of WT, constitutively active (Y527F and E378G) or kinase-dead (K295R) Src. We observed a decrease in FRET that was concordant with an increase in ITGB1 phosphorylation with the WT and constitutively active Src variants (Fig. 2b). This was reproduced using antibody-based approaches and correlated with an increase in the phosphorylation of p130Cas, a canonical Src substrate (Fig. 2c and quantified in Fig. 2d). Similarly, we developed an enzyme-linked immunosorbent assay (ELISA)-based method to assess the ability of recombinant proteins to alter the phosphorylation state of ITGB1 tail peptides (Fig. 2e), finding that Src directly phosphorylates these peptides (Fig. 2f). Moreover, through small-molecule inhibition of Src and Abl family kinases using saracatenib (Sara), we observed a significant decrease in both Src activation and ITGB1 phosphorylation (Extended Data Fig. 2i and quantified in Extended Data Fig. 2j). This was also detected with Illusia in MM231s and in telomerase-immortalized human fibroblasts (TIFs) (Fig. 2g). Altogether, we demonstrate ITGB1 as a direct substrate for Src and Arg kinases using Illusia, further supporting an active role for phosphorylation in integrin functions.

ITGB1 is actively dephosphorylated by PTPs

Given the role of Src and Arg kinases in regulating ITGB1 phosphorylation, we further investigated the dynamics of this post-translational modification by focusing on the opposing role of PTPs (Fig. 3a). Applying the broad-spectrum PTP inhibitor, sodium orthovanadate (${{\rm{VO}}}_{4}^{3-}$), we observed a rapid accumulation of ITGB1 phosphorylation over the treatment time course (Fig. 3b and quantified in Fig. 3c). A similar effect was again observed in the MM231 ITGB1(WT) and not in the ITGB1(YYFF)-expressing cells (Fig. 3d). Increased integrin phosphorylation was also evident by bulk pY immunoprecipitation (IP) and subsequent blotting for ITGB1 following ${{\rm{VO}}}_{4}^{3-}$ treatment (Extended Data Fig. 3a,b). Concordant with these data, ${{\rm{VO}}}_{4}^{3-}$ treatment significantly reduced Illusia FRET efficiency, and mutation to a non-phosphorylatable YYFF reporter abolished this effect, confirming that the changes upon treatment are phosphorylation-specific in both the MM231 (Fig. 3e) and TIF (Extended Data Fig. 3c,d) cell lines. Furthermore, additional mutations of the NPxY sites of Illusia supported the phosphorylation dependence of the FRET change and found that the Dok1 PTB predominantly binds to the NPxY(783) site (Extended Data Fig. 3e), as described previously¹¹. Importantly, Illusia remained intact upon treatment of MM231 or TIF cells with ${{\rm{VO}}}_{4}^{3-}$ (Extended Data Fig. 3f) or Sara (Extended Data Fig. 3g). In addition, Illusia did not coimmunoprecipitate ITGB1, suggesting no, weak or transient binding (Extended Data Fig. 3h). Cumulatively, these data support the phosphorylation-sensitive changes of Illusia and that active dephosphorylation of ITGB1 is dynamically balanced with kinase-mediated phosphorylation in cancer and normal cells (Fig. 3a).

**Fig. 3: PTPs actively regulate phosphorylation of the ITGB1 NPxY motifs.**

A high-content siRNA screen identifies putative ITGB1 PTPs

To identify the PTPs responsible for ITGB1 dephosphorylation, MM231 cells stably expressing Illusia were transfected, using an optimized protocol (Extended Data Fig. 4a and quantified in Fig. 4b), with a small interfering RNA (siRNA) library against 96 of the 108 predicted PTPs in the human genome²⁴. The RNA interference (RNAi) screen identified 18 PTPs where siRNA KD significantly decreased the FRET efficiency of Illusia, suggesting that they may be direct PTPs for ITGB1 (Fig. 4a). Unexpectedly, 57 PTP siRNAs significantly increased the FRET efficiency of Illusia, suggesting an indirect role of the phosphatase in upregulating ITGB1 phosphorylation (Fig. 4a and complete screen data in Supplementary Table 1). Notably, the silencing of the 16 most promising hits was efficient (Extended Data Fig. 4c). To further focus on those hits that were most likely to be direct ITGB1 PTPs, we filtered hits based on those that had been previously identified as part of the integrin meta-adhesome, linked to the consensus adhesome²⁵. PTPN11 (Shp2) and PTPN12 (PTP-PEST) were selected for downstream validation (the representative images from the screen in Fig. 4a are provided in Extended Data Fig. 4d) and changes in ITGB1 phosphorylation confirmed by fluorescence lifetime imaging microscopy (FLIM)–FRET (Fig. 4b (PTPN11) and 4c (PTPN12)) upon efficient silencing of either PTP (Extended Data Fig. 4e,f and quantified in Fig. 4d,e).

**Fig. 4: An RNAi FRET screen to identify regulatory PTPs for ITGB1 NPxY sites.**

Shp2 and PTP-PEST are direct PTPs for ITGB1

The data above demonstrate that loss of either Shp2 (PTPN11) or PTP-PEST (PTPN12) increases ITGB1 phosphorylation; however, the interaction between ITGB1 and these PTPs had not been assessed. Initially, we validated the ability of recombinant Shp2 and PTP-PEST to dephosphorylate phosphorylated ITGB1 tail peptides, detecting free phosphate released through this interaction (Fig. 5a,b). To confirm this interaction in cellulo, we employed expression constructs tagged with fluorescent proteins ideal for FLIM–FRET. This enabled us to observe that both PTPs directly interact with the ITGB1 tail (Fig. 5c,d), which was not observed with the control construct (clover tag alone) (Extended Data Fig. 5a). Furthermore, overexpression of Shp2 WT or a phosphatase-dead mutant in Illusia-expressing MM231 cells demonstrated a clear dependence on the phosphatase activity for the changes observed in ITGB1 phosphorylation by FLIM–FRET (Extended Data Fig. 5b) and western blot (Extended Data Fig. 5c) approaches. This approach yielded similar results for PTP-PEST (Extended Data Fig. 5d–f). Given that Shp2 is under clinical investigation for mutant-KRAS-driven cancers, several small molecules exist for specific inhibition of this PTP²⁶. A clinically relevant Shp2 inhibitor, SHP099, significantly upregulated ITGB1 phosphorylation in Illusia-expressing MM231 and TIF cells through both FLIM–FRET (Extended Data Fig. 5g,h) and western blot approaches (Extended Data Fig. 5i), further validating Shp2 as an important regulator of ITGB1 dephosphorylation.

**Fig. 5: ITGB1 is a substrate for PTP-PEST and Shp2.**

Disrupting ITGB1 phosphorylation reduces cell invasion

Our initial findings demonstrate that loss of ITGB1 phosphorylation reduces breast cancer invasion in vitro and in vivo (Fig. 1). Breast cancer progression entails increased tissue rigidity impacting many aspects of cancer through integrin-mediated mechanotransduction²⁷. This prompted us to investigate whether stiffness influences ITGB1 phosphorylation. We seeded Illusia-expressing cells on hydrogels of different stiffnesses, closer to that found in mammalian tissues and 3D cultures^28,29. By doing so, we observed increased ITGB1 phosphorylation at lower stiffnesses (Fig. 6a), occurring in parallel with a reduced cell area (Fig. 6b). This suggests that adhesion in softer environments, such as 3D and mouse models, may have a greater reliance on integrin phosphorylation than typical two-dimensional (2D) cultures on glass. This is in line with previous work demonstrating a continued reliance on Src and FAK for cancer cell survival in conditions with reduced adhesion^30,31. Indeed, it has been previously suggested that integrin phosphorylation may be increased on soft substrates in response to the lower number of mature adhesions, and our data is in line with that hypothesis³².

**Fig. 6: Src or Shp2 inhibition of ITGB1 phosphorylation dynamics results in equivalent phenotypes.**

Next, we assessed the relative contribution of the kinase ̶ phosphatase balance in this process by determining the effect of Sara (Src inhibitor) and SHP099 (Shp2 inhibitor) on proliferation of a panel of breast cancer cell lines, including the MM231 cells and another triple-negative breast cancer line, MDA-MB-468 (MM468) (Extended Data Fig. 6a). Here, we observed growth reduction only at high inhibitor concentrations (>5 μM). To unravel the role of Shp2 and Src on invasion, we kept inhibitor concentrations below this threshold and observed a dramatic effect on MM231 invasion in fibroblast-contracted 3D collagen I matrices (Fig. 6c, SHP099, and Extended Data Fig. 6b, Sara). We then explored this effect on invasion further using a basement membrane invasion assay that incorporates decellularized mouse mesentery to recapitulate basement membrane organization and characteristics more faithfully than in vitro polymerized gels, such as Matrigel³³ (Fig. 6d). In this system, both the Src and Shp2 inhibitors provoked a significant reduction in MM231 and MM468 cell invasion (Fig. 6e).

Interestingly, inhibition of either phosphorylation or dephosphorylation resulted in an anti-invasive effect, suggesting that phosphorylation dynamics could be essential for cancer cell movement through a 3D environment. While the number and size of IACs was unchanged between MM231 ITGB1(WT) or ITBG1(YYFF) cells (Extended Data Fig. 1g–i), live imaging revealed that IAC dynamics were significantly reduced in MM231s after SHP099 treatment (Supplementary Video 1 and quantified in Extended Data Fig. 6c). Similarly, MM231 cells embedded in a 3D matrix and treated with Src and Shp2 inhibitors showed a rounded morphology and reduced area (Fig. 6f), suggesting that their ability to adhere and move through the matrix was disrupted by loss of integrin phosphorylation dynamics. Furthermore, live tracking of Illusia using FRET by sensitized emission (SE-FRET) demonstrated rapid ITGB1 phosphorylation dynamics in cells invading in 3D collagen matrices (Extended Data Fig. 6d and Supplementary Video 2). This dynamic phosphorylation was lost following either SHP099 or Sara treatments where cells exhibited a rounded morphology. In 2D, SE-FRET confirmed a decrease in FRET signal in the SHP099 treatment condition and an increase with Sara, confirming the validity of the SE-FRET approach (Extended Data Fig. 6e). Altogether, we see that disrupting integrin phosphorylation dynamics through mutation of the receptor’s NPxY sites or small-molecule inhibition of the identified integrin kinase or phosphatase leads to a reduction in breast cancer invasion in 2D and 3D settings.

Cofilin is recruited to the phosphorylated ITGB1/Dok1 complex

Several studies have characterized the adhesion complex recruited upon talin binding to the cytoplasmic domain of ITGB1 (refs. ^1,12). By contrast, little is known about the composition of the phosphorylated complex. To identify the proteins recruited upon Dok1 binding to phosphorylated ITGB1, we performed bimolecular complementation affinity purification (BiCAP) (Fig. 7a) and mass spectrometry on the immunoprecipitated complex³⁴ (Fig. 7b and Supplementary Table 2). This identified 25 proteins (including ITGB1 and Dok1) that were significantly enriched in the BiCAP condition. Three of these, Cofilin, VPS35 and annexin A6, were then further validated by western blot using green fluorescent protein (GFP)-trap IP (Fig. 7c). The formation of these complexes within intact MM231 cells was further supported by bimolecular fluorescence complementation (BiFC)–FLIM–FRET (Fig. 7a), performed between the ITGB1/Dok1 complex and red fluorescent protein (RFP)-tagged Cofilin (Fig. 7d), VPS35 or annexin A6 (Extended Data Fig. 7a). Interestingly, the interaction with Cofilin occurred independently of Cofilin phosphorylation state, suggesting that both active and inactive Cofilin could be recruited to the ITGB1/Dok1 complex (Fig. 7d).

**Fig. 7: Phosphorylation-sensitive recruitment of Dok1 supports invadopodia formation.**

Cofilin is an essential actin regulator, implicated in invasion and the generation of matrix-degrading invadopodia^35,36. Arg and Src are also linked with invadopodia formation through the phosphorylation of cortactin to release Cofilin^37,38. Therefore, we next assessed the role of Src and the ITGB1/Dok1 complex in invadopodia formation (Extended Data Fig. 7b). Overexpression of constitutively active Src kinase induced invadopodia formation, as expected³⁹, but this was significantly reduced in cells with non-phosphorylatable ITGB1(YYFF) (Extended Data Fig. 7c). Furthermore, siRNA silencing of DOK1 resulted in a dramatic loss of Src-induced invadopodia in both ITGB1 WT and YYFF backgrounds (Fig. 7e), together supporting the link between invadopodia formation and the phosphorylated ITGB1 complex. Notably, silencing of Dok1 resulted in a more pronounced phenotype than non-phosphorylatable ITGB1, suggesting that the role of ITGB1 can be compensated by other adhesion receptors but that the scaffolding functions of Dok1 are less dispensable for invadopodia formation. This is further supported by the established phosphorylation-specific binding of Dok1 to other integrin β isoforms^11,40.

Dynamic ITGB1 phosphorylation supports invadopodia formation

Invadopodia comprise a well-established set of proteins, with the scaffold proteins cortactin (CTTN) and TKS5 among the most explored. Since very few invadopodia components were identified in the BiCAP, we took a more targeted approach using intermolecular FRET to assess the interaction of the phosphorylated ITGB1 complex with these scaffold proteins. We observed that Dok1 and Cofilin interact with both CTTN and TKS5 (Fig. 8a–d). Furthermore, Dok1 silencing strongly downregulated Cofilin and, to a lesser extent, TKS5 and CTTN protein levels (Extended Data Fig. 8a and quantified in Extended Data Fig. 8b). Dok1 was clearly reduced at the RNA level, consistent with efficient silencing by the siRNAs, while the other invadopodia components showed variable responses to Dok1 silencing (Extended Data Fig. 8c), suggesting that the observed coregulation occurs primarily at the protein, not mRNA level and could involve altered stability of invadopodia components in the absence of Dok1. Taken together, these data demonstrate a novel requirement for the phosphorylated integrin complex and the ensuing interactions with Cofilin, TKS5 and CTTN for invadopodia formation and function. These data are concordant with the requirement for ITGB1 phosphorylation for local invasion away from the primary tumour (Fig. 1).

**Fig. 8: The Dok1/ITGB1 complex recruits Cofilin and other invadopodia components to adhesion sites to mediate efficient cancer dissemination.**

Dynamic ITGB1 phosphorylation supports metastasis

To investigate the role of integrin phosphorylation dynamics during later stages of the metastatic cascade, we utilized an animal model of extravasation and metastatic colonization of the lung. To track this process, we engineered MM231 ITGB1(WT or YYFF) cells to express a luciferase/EGFP construct (Extended Data Fig. 8d), observing equivalent luciferase signal in the lung immediately after injection of the cells into the lateral tail vein (Extended Data Fig. 8e and quantified in Extended Data Fig. 8f). The mice injected with MM231 ITGB1(WT) cells showed higher outgrowth of lung metastases compared with the MM231 ITGB1(YYFF) cells (P = 0.0939) (Fig. 8e and quantified in Fig. 8f) along with a greater metastatic area (P = 0.1051) (Extended Data Fig. 8g). Furthermore, treatment of mice with the Shp2 inhibitor, SHP099, reduced the number of metastatic nodules and the overall tumour mass in the lung (P = 0.3622) (Fig. 8g and quantified in Fig. 8h). Interestingly, more granular assessment of the ratio of micro- to macrometastasis demonstrated further the requirement for integrin phosphorylation, observing a slight increase in the ratio towards micrometastasis in ITGB1(YYFF) cells, when compared to the WT controls (Extended Data Fig. 8h). Given the similar sensitivity of both MM231 ITGB1(WT) and ITGB1(YYFF) cells to flow-induced cell death in suspension, these differences are unlikely to reflect differences in cell survival in the circulation (Extended Data Fig. 8i,j). While these data did not reach statistical significance, they show a trend in line with a requirement for integrin phosphorylation dynamics during effective cancer dissemination (Fig. 8i). Together, we propose a mechanism where finely controlled integrin phosphorylation and dephosphorylation regulate cell invasion and cancer dissemination through invadopodia formation and play a key role at distinct steps of the metastatic cascade.

Discussion

Here, we show that dynamic ITGB1 phosphorylation facilitates the recruitment of a proinvasive Dok1 complex to support invadopodia formation, cancer invasion and metastatic dissemination. Through the development of Illusia, a FRET reporter for ITGB1 phosphorylation, we demonstrate spatiotemporal regulation of this post-translational modification in invading cells. We identify and validate two integrin PTPs, Shp2 and PTP-PEST and, conversely, demonstrate increased integrin phosphorylation by Src and Arg kinases. Strikingly, inhibition of either Src or Shp2 dramatically inhibits cell migration and invasion, demonstrating that dynamic integrin phosphorylation is important for efficient cancer invasion and metastatic colonization. Furthermore, Dok1 binding to phosphorylated ITGB1 facilitates recruitment of the actin-severing protein Cofilin, along with the invadopodia scaffolds TKS5 and CTTN. Importantly, this invadopodia complex is lost in cells with non-phosphorylatable ITGB1 YYFF, which demonstrate compromised invadopodia formation and invasion.

On the whole-cell level, integrins impact cell migration by regulating front-rear polarity and signalling^41,42. In our study, live-cell imaging appears to show fluctuations in phosphorylation (Illusia reporter) in invading cells, with flickering and regional differences at the leading and trailing edges (Supplementary Video 2). This implies that integrin phosphorylation may be polarized in cells, probably coordinated by rapid phosphorylation cycles of individual integrin molecules. The constant switching between talin-bound non-phosphorylated ITGB1 and the phosphorylated integrin/Dok1 multiprotein complex may facilitate tuning of adhesion receptor functions through exchange of proximal interactors and thus contribute to front-rear polarity and cell migration. Future studies are needed to interrogate how this is governed across scales (from single molecules to cells) and fine-tuned by tyrosine kinase/phosphatase networks. One insight comes from a study demonstrating Shp2 regulation of focal adhesion kinase activity at the cell periphery and nascent adhesion formation consistent with lamellipodia spreading⁴³. Similarly, the Shp2 ability to promote IAC maturation through ROCK2 activation indicates that phosphorylation dynamics are important to modulate the activation state of different IAC components to ensure that dynamic processes are not stalled by over/underactivation⁴⁴ (further discussed in ref. ⁴⁵). Notably, a screening study assessing the binding of several PTB-domain-containing adaptor proteins to an NxxY-peptide array identified three potential phosphorylation-dependent binding partners, Appl, Dok2 and Frs2 (ref. ⁴⁶). Interestingly, loss of Frs2 has recently been shown to sensitize cells to Shp2 inhibition, suggesting a further link between cancer progression and additional phosphorylation-sensitive integrin complexes⁴⁷. Such studies highlight the diversity of adhesion complexes and the role of post-translational modifications in modulating their functions within the cell.

There are no obvious cell migration defects reported for mice carrying the ITGB1 YYFF mutant^5,9. However, in organisms with fewer integrin isoforms, YYFF mutation of the ITGB1 orthologs leads to defects in distal tip cell migration and ovulation (Caenorhabditis elegans) and disruption of the myotendinous junctions (Drosophila melanogaster)^48,49. It is important to note that the two conserved cytoplasmic NxxY motifs are present in multiple integrin β-subunits and Dok1 can interact with them⁵⁰. The significant decrease in invadopodia observed after Dok1 KD (Fig. 7e) suggests that Dok1 could be a core component for invasion mediated by multiple integrins and implies a wider impact of our findings. Furthermore, the finding that ITGB1 phosphorylation is increased on softer substrates (Fig. 6a,b) was initially surprising given previous findings that global tyrosine phosphorylation is reduced in softer environments⁵¹. Yet, primary human fibroblasts have been shown to increase their invadopodia formation on softer hydrogels⁵², and the Src activation state is maintained in both soft and stiff conditions in both cancer and fibroblast cell lines^52,53. Taken together, these data affirm the significance of ITGB1 phosphorylation dynamics for cell invasiveness and highlight the need for continued investigation into the role of adhesion signalling in different stiffness environments.

While several studies have explored the potential of ablating ITGB1 with genetic approaches, demonstrating reduced breast tumour growth and metastasis in xenograft and genetically engineered mouse models^14,54,55, targeting integrin heterodimers, has so far failed to show efficacy in a cancer setting^13,56. Given the central role of integrins in cancer progression, the identification of new regulatory vulnerabilities, such as the one described herein, provides new avenues for therapeutic development. Src inhibition has already been demonstrated as an effective antimetastatic therapy in MM231 cells^57,58, and recent work has found similar efficacy for SHP099 in reducing lung colonization by mouse 4T1 breast cancer cells⁵⁹. This is in line with reduced extravasation when invadopodia components, namely CTTN, LPP and MT1-MMP, are removed from breast cancer cells^37,60,61. The opposite is also true for overexpression of the invadopodia scaffold TKS5, which increases lung cancer⁶² and melanoma⁶³ metastasis. Here, we describe integrin phosphorylation as an apparent ‘switch on signal’ for invadopodia formation, leading to Dok1 recruitment to the integrin cytoplasmic tail, followed by Dok1-mediated complex formation with CTTN, Cofilin and TKS5. These data highlight the potential of inhibiting integrin phosphorylation regulators to reduce invadopodia formation and ultimately reduce metastatic dissemination.

Another interesting, unexplored finding is the range of PTPs identified in our FRET screen as having the potential to increase ITGB1 phosphorylation. These PTPs probably regulate integrin phosphorylation indirectly by converging on kinase activity and signalling pathways, providing additional complexity to integrin phosphorylation dynamics. This level of control emphasizes the central role of integrin adhesion receptors and their dynamic phosphorylation in regulating cell behaviour.

Methods

All animal experiments were performed in accordance with The Finnish Act on Animal Experimentation (Animal licence number ESAVI/12558/2021). All experiments respected the maximum tumour diameter (15 mm) permitted by the authorization bodies.

Animal experiments

Subcutaneous xenografts were generated in the flank of 7–8-week-old female athymic nude mice (Foxn1^nu, Envigo) by injecting 3 × 10⁶ MM231 ITGB1(WT or YYFF) cells in phosphate-buffered saline (PBS). The tumours were then tracked by palpation with callipers until the tumour volume ($\frac{{\rm{length}}\times {{\rm{width}}}^{2}}{2}$) was >300 mm³, at which point the mice were sacrificed and tumours were collected. Quantification of local invasion and Ki67-positive nuclei was performed in QuPath⁶⁴, as described previously^65,66, on xenografts with a smaller cross-sectional area than 300,000 µm² that showed local invasion.

Colonization of the lung was assessed through lateral tail vein injection of 100 μl PBS with 7.5 × 10⁵ MM231 ITGB1(WT or YYFF) cells expressing luciferase/EGFP into 7–8-week-old female athymic nude mice (Foxn1^nu, Envigo). The cells were treated with dimethyl sulfoxide (DMSO) or SHP099 (100 nM) 24 h before injection. Oral gavage of the vehicle (0.5% methylcellulose, 0.1% Tween80 in sterile water) or SHP099 (100 mg kg⁻¹) was then performed daily for 5 days, starting from day 0, 2–3 h before tail vein injections. To reduce oesophageal irritation from repeated gavage, 24% sucrose in sterile water was applied to the needles for each gavage⁶⁷. The metastatic growth was tracked using d-luciferin (150 mg kg⁻¹; PerkinElmer, 122799) through intraperitoneal injection and imaging on an IVIS spectrum (PerkinElmer). Lungs were collected 28 days later, taking the large lobe for paraffin embedding after formalin fixation and sending the remaining lobes for RNA isolation.

The mice were housed in standard conditions (12-h light–dark cycle; ambient temperature, 21 °C; 50% ± 8% humidity) with food and water available ad libitum.

Anoikis assays

To measure the resistance of cells to anoikis and shear forces, a custom-made flow system was developed. This was composed of a peristaltic pump for flow induction (Ismatec, Reglo digital, MS-4/12) and microfluidic tubing with a closed-loop circuit, composed of 50 cm silicon tubing (Ibidi, 10840) and a three-stop connector compatible with the Ismatec pump (Tygon 0.38 ID; Ismatec, SCE0398) linked together with 23G needles. The cells were perfused into this system after resuspending in 1 ml of complete media and treating with SHP099, DMSO or a mixture of cell-death-inducing compounds as a positive control (doxorubicin (10 µg ml⁻¹; Selleckchem, E2516), ${{\rm{VO}}}_{4}^{3-}$ (50 µM), gemcitabine (10 µM; Selleckchem, S1149)), as indicated. For the ‘no flow’ controls, the cells were seeded in ultralow attachment plates (Corning, 3471) for 24 h. Whereas the ‘flow’ samples were taken from these ultralow attachment plates after 22 h and aspirated into the microfluidic system before closing the circuit. A capillary-like flow of 400 µm s⁻¹ was used as pump input for 2 h, as described previously⁶⁸. The cells from all conditions were then collected, and annexinV staining was performed following the manufacturer’s instructions (Abcam, ab219919). Flow cytometry data acquisition was performed on a BD LSRFortessa Cell Analyzer (BD Biosciences), using FlowJo software (version 10.8.2, BD Biosciences) for the analysis.

Basement membrane invasion assays

The mesenteric basement membrane was surgically extracted from mouse intestines, then adhered to the bottom of a plastic transwell insert (Greiner, Thincerts, 8 μm pore size, 662638) after first removing the filter with a scalpel, as described previously³³. The mesentery was then decellularized using NH₄OH (1 M) in PBS with 1% Triton X-100 for 60 min. These were then washed 4× with PBS, treated with DNAse I (10 μg ml⁻¹, Roche) in PBS for 30 min at 37 °C, washed 1× with PBS and left overnight at 4 °C in PBS containing calcium and magnesium. Next, mesenteries were seeded with 3 × 10⁵ mScarlet-overexpressing TIFs/membrane in 50 μl of a 1:4 collagen:FBS mix, neutralizing the collagen I as described previously^16,65, allowing this to set at 37 °C before adding complete growth medium and incubating overnight at 37 °C with 5% CO₂. MM468 or MM231 cells (final concentration of 1 × 10⁶ cells per membrane) overexpressing EGFP were then seeded in the top of these mesenteric membranes and a chemoattractive gradient was established with complete media in the bottom of the Transwell and serum free media in the top. MM231 or MM468 cells were then treated with Sara (SelleckChem, S1006) and SHP099 (SelleckChem, S8278) for 4 or 5 days, respectively, refreshing the media every 2 days. At the end of the invasion period, the mesenteries were treated with CNA35-HaloTag recombinant protein (270 μg ml⁻¹), as well as HaloTag far-red ligand (10 nM; Promega, JaneliaFluor 646, GA1120) before fixation and staining with 4′,6-diamidino-2-phenylindole (DAPI) (dihydrochloride; 1 μg ml⁻¹, Life Technologies, D1306) and then imaged on a Zeiss LSM880 with Airyscan and the 40× Zeiss LD LCI Plan-Apochromat objective.

BiCAP mass spectrometry

BiCAP was performed as described previously³⁴, using MM231 or HEK293T cells transfected with either pDEST-ITGB1-V1/pDEST-Dok1-V2 or control pEF.DEST51-mVenus using Lipofectamine 3000 (Thermo Fisher) in OptiMEM (Gibco, 31985070), as per the manufacturer’s protocol. After an overnight incubation, the cells were lysed in IP lysis buffer (40 mM HEPES buffer, 75 mM NaCl, 2 mM EDTA, 1% NP-40, along with protease (cOmplete Mini, EDTA-free, Roche) and phosphatase (PhosSTOP, Roche) inhibitor cocktails) and subjected to IP using GFP-trap beads (30 μl, Chromotek, gfa), at 4 °C with gentle agitation for 1 h. The samples were then spun down at 300g for 5 min and the beads washed three times with PBS and once with 50 mM Tris–HCl, pH 8.0, 150 mM NaCl. The on-bead digestion and liquid chromatography–tandem mass spectrometry were performed as described previously⁶⁵, before the assignment of peptides and label-free quantification of abundance ratios (normalized to total peptide amount) in Proteome Discoverer 2.5 (Thermo Fisher) using intensity values from the precursor ions.

Cell line models

TIFs (a kind gift from J. C. Norman, Beatson Institute)⁶⁹, HEK293FT (Thermo Fisher, R70007), HEK293T (ATCC, CRL-3216), MM231 (ATCC, HTB-26), MM468 (ATCC, HTB-132), HCC1937 (ATCC, CRL-2336) and MDA-MB-361 (ATCC, HTB-27) cells were all cultured in Dulbecco’s modified Eagle medium (Sigma, D2429) supplemented with 10% FBS (20% FBS for the MDA-MB-361 cells) and l-glutamine (100 mM). MCF10A (ATCC, CRL-10317) cells were cultured in Dulbecco’s modified Eagle medium/F12 (Invitrogen, 11330-032) supplemented with 5% horse serum, EGF (20 ng ml⁻¹; Peprotech, AF-100-15), hydrocortisone (0.5 mg ml⁻¹; Sigma, H0888), cholera toxin (100 ng ml⁻¹; Sigma, C8052) and insulin (10 µg ml⁻¹; Sigma, I9278). All cell lines were regularly tested for mycoplasma and were found to be negative. The MM231s were authenticated by STR profiling using the services of the Leibniz Institute DSMZ. BT-20 (ATCC, HTB-19) cells were cultured in minimum essential medium (Thermo Fisher, 31095052) supplemented with 10% FBS and l-glutamine (100 mM).

FLIM–FRET microscopy

Frequency-domain FLIM–FRET was performed using a LIFA fast frequency-domain FLIM system (Lambert Instruments) attached to an inverted microscope (Zeiss AXIO Observer.D1) with sinusoidally modulated (40 MHz) epi-illumination (1 W for 405 nm or 3 W for 470 nm) from a temperature-stabilized multi-light-emitting diode (LED) system (Lambert Instruments) and a ×63/1.15 objective (Zeiss, Objective LD C-Apochromat ×63/1.15 W Corr M27). Atto425 (1 µM; Sigma, 56759) or fluorescein (20 µM; Sigma, F7505) in PBS/0.1 M Tris, pH 7.5 were used as lifetime reference standards. An appropriate filter set for mTurquoise2 (FT 455, no excitation filter//475/20) or Clover/EGFP (FT 480, 450/50//510/50) was used to measure the phase and modulation fluorescence lifetimes per pixel from images of cells acquired at 12 phase settings, using the manufacturer’s software. The apparent FRET efficiency (${E}_{{\mathrm{app}}}$) was calculated using the measured lifetimes per cell of each donor–acceptor pair (${{\rm{\tau }}}_{{\mathrm{DA}}}$) and the average lifetime of the donor-only (${{\rm{\tau }}}_{{\mathrm{D}}}$) samples,

$${E}_{{\mathrm{app}}}=(1-{{\rm{\tau }}}_{{{\mathrm{DA}}}}/{{\rm{\tau }}}_{{\mathrm{D}}})\times 100.$$

Flow cytometry

MM231 ITGB1(WT or YYFF) cell lines were trypsinized, fixed in 2% PFA for 10 min at room temperature and washed with PBS before being stained with primary antibodies to assess surface integrin levels (1:100 dilution in Tyrode’s buffer (ITGB1 (clone P5D2, in-house production from DSHB hybridoma), inactive ITGB1 (clone mAb13, in-house production from DSHB hybridoma) and β3 (MCA728, AbD Serotech))) for 1 h at 4 °C with gentle agitation. The samples were then washed 2× with PBS and incubated with secondary antibodies (ALEXA-488 conjugated anti-mouse/anti-rat Invitrogen; 1:300 dilution in Tyrode’s buffer) for a 1 h at 4 °C with gentle agitation. The cells were then washed again with PBS before being resuspended in 200 µl of PBS and loaded into a 96-well plate. Cytometry was then performed on an LSRFortessa Cell Analyzer using the High Throughput Sampler (BD Biosciences). Up to 10,000 single cell events were collected per condition. Gating and statistical analysis of the cell population were performed in FlowJo (version 10.8.2, BD Biosciences).

Gene silencing

Gene silencing was performed by transfecting 10 nM siRNA using RNAiMAX, as per the manufacturer’s instructions. The non-target control (NTC) (AllStars negative control), Dok1_1 (Hs_Dok1_2, SI00372799, AAGGATCCCAATTCGGGTAA) and Dok1_2 (Hs_Dok1_3, SI00372792, CCGCCTGGACTGCAAAGTGAT) siRNAs were all purchased from QIAGEN. For the siRNA screen, two negative controls (Silencer Select negative control 1 (s813; 4390843) and Silencer Select negative control 2 (s814; 4390846)) and the Silencer Select Human Phosphatase library (4397919) were used (Thermo Fisher Scientific, Ambion). GFP silencing was performed with a Silencer Select anti-GFP siRNA (Thermo Fisher Scientific, Ambion, s229077, 4399665). The RNAi library was resuspended and reformatted into the plates with a Biomek NXP pipetting robot (Beckman Coulter) and ATS100 acoustic nanodispenser (EDC biosystems) under laminar flow (Kojair).

Generation of stable cell lines

For stable expression of the mRuby2-tagged ITGB1 WT and YYFF and the Illusia and Illusia(YYFF) intramolecular FRET biosensors, MM231 cells were cotransfected with the respective pPB.DEST vectors and pCMV-hyPBase (Supplementary Table 3), using Lipofectamine 3000, as per the manufacturer’s protocol (Thermo Fisher Scientific). The stable fluorescent cells were then isolated by FACS within a narrow fluorescence range.

The lentiviral particles for the generation of stable cell lines were packaged in HEK293FT packaging cells by cotransfecting the third-generation lentiviral packaging system, pMDLg/pRRE, pRSV-Rev and pMD2.G, along with one of several transfer plasmids (that is, pLKO.1-shBeta1, pLV430g-ofl_T2A_EGFP, pLenti6.3/TO/V5-DEST-Paxillin-EGFP, pLenti6.3/TO/V5-DEST-EGFP, pLenti6.3/TO/V5-DEST-mScarlet, pINDUCER20-Src(WT), pINDUCER20-Src(E378G), pINDUCER20-Src(K295R), pINDUCER20-Src(Y527F), pINDUCER20-ABL2(WT), pINDUCER20-ABL2(K281M), pINDUCER20-PTPN12 or pINDUCER20-PTPN12(D199A,C231S); Supplementary Table 5) using Lipofectamine 3000 (Thermo Fisher) in OptiMEM (Gibco, 31985070), as per the manufacturer’s protocol. A total of 24 h after transfection, the medium was replaced with complete growth medium for a further 24 h, at which point the medium was collected and filtered through a 0.45-µm syringe filter. MM231s or TIFs were then transduced with the lentiviral particles for 48 h, in the presence of Polybrene (8 µg ml⁻¹; Sigma, TR-1003-G), before washing and selecting stable positive cells using puromycin (1 µg ml⁻¹). Where fluorescent constructs were used, stable cells were then isolated by FACS within a narrow fluorescence range.

IP

The cells were collected in 300 μl IP lysis buffer (40 mM HEPES, 75 mM NaCl, 2 mM EDTA, 1% NP-40, along with protease (cOmpleteTM Mini, EDTA-free, Roche) and phosphatase (PhosSTOP, Roche) inhibitor cocktails) using a plastic cell lifter. They were then incubated in the IP lysis buffer for 1 h with vigorous rotation at 4 °C. The lysates were then centrifuged at 20,000g at 4 °C for 10 min, and the cleared lysate was transferred to a new Eppendorf tube; 30 μl was added to 7 μl of 8× sample buffer (SB; 0.66 M Tris-HCl, pH 6.8, 33% glycerol, 398 μM bromphenol blue, 266 mM dithiothreitol (DTT; Sigma, D0632), 740 mM sodium dodecyl sulfate) to use as an input control. The remainder of the cleared lysate was incubated for 1 h at 4 °C with anti-pY affinity beads (30 μl per sample, APY03-Beads, Cytoskeleton) or GFP-trap beads (30 μl, Chromotek, gfa), as appropriate. These were prewashed with ice-cold wash buffer (150 mM NaCl, 1% NP-40 in water). The beads were then washed 3× with ice-cold wash buffer by centrifugation at 800g for 1 min. The wash buffer was then removed and 4× SB with 100 mM DTT was added to the beads, and the samples were boiled for 10 min at 95 °C to denature the bead–protein interactions and recover the proteins. For pY IPs, the cells were treated with sodium orthovanadate (${{\rm{VO}}}_{4}^{3-}$; activated, Calbiochem, 5 ml, 5086050004) or water for 2 h at 37 °C before collection. Notably, all IP experiments were performed using ~90% of the sample as input and keeping 10% for the loading control.

Immunohistochemistry

Fibroblast-contracted 3D collagen I matrices and xenograft tumours were embedded in paraffin after fixation in 10% neutral buffered formalin, as described previously^16,65. The sections, 4-μm thick, were then stained with either haematoxylin and eosin (H&E) or primary antibodies against Ki67 (Dako, M7240, 1:500), EGFP (Invitrogen, A-11122, 1:800) or pan-cytokeratin (Invitrogen, MA5-13203, 1:25). The slides were scanned on a Pannoramic P1000 (3DHISTECH, 20×/0.8 objective).

Invadopodia imaging

Eight-well dishes (µ-Slide 8 well ibiTreat; iBidi, 80826) for invadopodia assessment were coated with fluorescent gelatin, as described previously⁷⁰. Briefly, Oregon green-488-conjugated gelatin (Thermo Fisher, G13186) and 5% (w/w) unlabelled gelatin (Sigma, G2500-100G)/sucrose (Sigma, S9378) solution were prewarmed to 37 °C. The wells were coated with 50 µg ml⁻¹ poly-l-lysine (Sigma, P9155) and incubated at room temperature for 20 min. The solution was aspirated, and the wells were washed three times with PBS. A freshly made 0.5% glutaraldehyde solution (Sigma, 340855) was added to each well and incubated on ice for 15 min, followed by three washes with cold PBS. The Oregon green-488-conjugated gelatin was diluted with the unlabelled 5% stock gelatin in a 1:8 ratio and added to the wells. This gelatin mixture was then incubated for 30 min at 37 °C, in the dark. The excess mixture was removed by vacuum aspiration, and the wells were incubated in the dark for 10 min at room temperature, then washed three times with PBS. A freshly made 5 mg ml⁻¹ sodium borohydride (Sigma, 452882) solution was then added to the wells and incubated for 15 min at room temperature. The sodium borohydride was removed, wells washed three times with PBS and incubated with 70% ethanol for 30 min at room temperature. The dishes were then transferred to cell culture laminar flow hoods and washed three times with sterile PBS. Before each experiment, the dishes were equilibrated with cell culture medium for >1 h at 37 °C.

To assess invadopodia formation, MM231 cells with Dox-inducible Src mutants in stably incorporated lentiviral cassettes were transfected with either siNTC or siDok1 siRNAs and treated with or without Dox (1 µg ml⁻¹) for 24 h before plating on fluorescent gelatin-coated iBidi dishes for 6 h. The cells were then fixed with 4% PFA (Thermo Fisher, 28908)/0.25% Triton X-100 for 10 min at 37 °C, before washing with PBS and blocking overnight with 2% bovine serum albumin (BSA) (Sigma, A8022)/1 M glycine (ITW Reagents, A1067)/PBS. The blocked samples were then incubated with SiR-Actin for 1 h at room temperature followed by staining with DAPI (Life Technologies, D1306). The imaging was performed using a spinning disk confocal (3i Marianas CSU-W1) microscope with a Zeiss Plan-Apochromat ×63/1.4 oil immersion objective.

Gelatin degradation was quantified by creating a mask for degraded areas per field of view. This was then normalized to the number of cells in each field measured using DAPI. The resultant ‘degradation area per cell (units µm² per cell)’ for each field of view was plotted for further statistical analysis using Prism 7 (GraphPad Software).

Invasion into fibroblast-contracted 3D collagen I matrices

Fibroblast-contracted ‘organotypic’ 3D collagen I matrices for invasion assays were generated as described previously^16,65, using TIFs to contract the matrices. Quantification of the MM231 ITGB1(WT or YYFF) proliferation or invasion indices was performed in QuPath⁶⁴, using the positive cell detection algorithm over eight regions of interest. For invasion assessment, the fraction of cells in a region of interest that had invaded beyond 100 μm was compared with the total number of cells in that region.

Malachite green phosphate detection

Detection of free phosphate associated with phosphatase activity was achieved through the use of a Malachite Green Phosphate Detection Kit (Cell Signaling, 12776) using the following recombinant biotinylated peptide fragments of ITGB1 (Genscript; Bio-ITGB1_27aa_tail: NAKWDTGENPIYKSAVTTVVNPKYEGK, Bio-ITGB1Y783P_27aa_tail: NAKWDTGENPI[pY]KSAVTTVVNPKYEGK, Bio-ITGB1Y795P_27aa_tail: NAKWDTGENPIYKSAVTTVVNPK[pY]EGK or Bio-ITGB1Y783PY795P_27aa_tail: NAKWDTGENPI[pY]KSAVTTVVNPK[pY]EGK. Each fragment (2,400 pmol per peptide per reaction) was incubated separately for 1 h at 37 °C with recombinant Shp2 (0.05 μg ml⁻¹; R&D Systems, 1894-SH-100) or PTP-PEST (0.05 μg ml⁻¹; SignalChem, P39-21G-10) in phosphatase buffer (HEPES buffer, pH 7.5 (50 mM)/EDTA (0.2 mM)/DTT (5 mM)/Triton X-100 (0.01%)), before incubation with Malachite Green Reagent (100 µl per reaction). The colour was allowed to develop for 15 min at room temperature, then absorbance read at 640 nm. The absorbance from the blank solution was then subtracted from the sample wells, and the free phosphate was calculated from a standard curve generated through titration of a phosphate standard and detection using the Malachite Green Reagent, as above.

Molecular cloning

Illusia was initially synthesized (Supplementary Table 3) and cloned into the pDONR221 plasmid (Thermo Fisher) by GeneArt (Thermo Fisher). To generate the phosphorylation-defective pENTR221-Illusia(YYFF), pENTR221-Illusia(Y783F) or pENTR221-Illusia(Y795F) constructs or the phospho-mimetic pENTR221-Illusia(YYEE) construct, the YYFF_top/YYFF_bottom, Y783F_top/Y783F_bottom, Y795F_top/Y795F_bottom or YYEE_top/YYEE_bottom oligonucleotides (Supplementary Table 4) were annealed respectively and ligated into the NotI/BspEI digested pENTR221-Illusia backbone.

To generate the ITGB1 mutants, WT ITGB1 was PCR amplified from mCherry-Integrin-Beta1-N-18 using ITGB1_F and ITGB1_R (Supplementary Table 4), before ligation into pENTR2b after digestion with KpnI/XhoI. The silent mutations were then introduced between base pairs 2731–2751 from gccttgcattactgctgatat to gccttgcGttactCctCatTt, to create an shRNA-resistant construct against the shRNA expressed by the pLKO.1-shBeta1 vector. The YYFF ITGB1 variant was then PCR amplified and religated back into pENTR2b with KpnI/XhoI, using the PCR primers ITGB1_F, ITGB1(YYFF)_R (Supplementary Table 4). These shRNA-resistant constructs were then tagged with mRuby2 using overlap-extension PCR on the pcDNA3-mRuby2, pENTR2b-ITGB1(WT) or -ITGB1(YYFF) templates with the ITGB1_OEC_F, ITGB1(WT)_OEC_R, ITGB1(YYFF)_OEC_R, mRuby2_OEC_F and mRuby2_OEC_R (Supplementary Table 4), ligating into the pENTR2b backbone after digestion with KpnI/XhoI.

Src(WT) and Src(Y527F) were PCR amplified from pBABE-Src-Rescue using the Src_F and Src_R or Src_Y527F_R primers respectively (Supplementary Table 4), then ligated into pENTR2b after digestion with KpnI/XhoI. To generate Src(K295R) and Src(E378G), the pENTR2b-Src(WT) plasmid underwent site-directed mutagenesis at Gene Universal. For Arg kinase, the pDONR223-ABL2 construct was used as a template for site-directed mutagenesis (Gene Universal) to first remove the K115M mutation present in the Addgene construct to yield the pENTR223-ABL2(WT) construct. This then underwent further site-directed mutagenesis to yield the pENTR223-K281M (Gene Universal).

The pENTR2b-Paxillin-EGFP was generated through PCR amplification of the Paxillin–EGFP cassette from the pEGFP–C2 backbone⁷¹ using the primers Paxillin–EGFP_F and Paxillin–EGFP_R (Supplementary Table 4). The PCR fragment was then digested with XhoI/NotI and ligated into the similarly digested pENTR2b. Similarly, for pENTR2b–EGFP, the EGFP fragment was PCR amplified from the pEGFP-N1 vector using EGFP_F and EGFP_R. An acceptor-only FRET control vector was generated for YPet through PCR amplification using pENTR221-Illusia and the PCR primers YPet_F and YPet_R. Then pENTR2b backbone and PCR fragment were both digested with XhoI/KpnI and ligated together to yield pENTR2b-YPet.

Intermolecular FRET constructs were generated for Dok1 by overlap-extension PCR using the pDONR223-Dok1(no stop) and pcDNA3–Clover plasmids as templates and the Dok1_OEC_F, Dok1_OEC_R, Clover_OEC_F and Clover_OEC_R primers, ligating into pENTR2b after digestion with NcoI/EcoRV to generate pENTR2b-Dok1-Clover. For VPS35 and AnnexinA6, C-terminally tagged mScarlet constructs were synthesized at BioCat in the pENTR221 vector backbone.

Shp2 and PTP-PEST were PCR amplified from pCMV6-PTPN11 and pCMV-PTPN12, respectively, using the PTPN11_F/PTPN11_R1 or PTPN12_F/PTPN12_R1 primer pairs, respectively (Supplementary Table 4). These were then digested and ligated into the pENTR2b backbone to generate pENTR2b-PTPN11 and pENTR2b-PTPN12. These then underwent site-directed mutagenesis at Gene Universal to generate pENTR2b-PTPN12(D199A,C231S) and -PTPN11(D425A,C459S). To generate Clover-tagged constructs, Shp2 and PTP-PEST were PCR amplified from the WT and mutant constructs using the PTPN11_F/PTPN11_R2 or PTPN12_F/PTPN12_R2 primer pairs, respectively (Supplementary Table 4), followed by ligation of the digested fragments into pENTR2b-Dok1-Clover after excision of Dok1 using NotI/SalI.

For the BiFC/BiCAP, V1- or V2-tagged constructs were generated by LR reactions with the pDEST-ORF-V1 or pDEST-ORF-V2 plasmids and either pDONR223-Dok1(no stop) or pENTR221-ITGB1(no stop). The pENTR221-ITGB1(no stop) was generated by PCR of ITGB1 from pENTR2b-ITGB1(WT) using ITGB1_attB1_F and ITGB1_attB2_R, then a BP reaction (BP clonase II, Thermo Fisher Scientific) with pDONR221.

The above shuttle vectors were then subcloned into pEF.DEST51, pINDUCER20, pPB.DEST and pLenti6.3/TO/V5-DEST by performing an LR reaction (LR clonase II, Thermo Fisher Scientific) with the pENTR221 or pENTR2b constructs described above, as necessary (Supplementary Table 5). LR reactions were also performed as indicated into the custom pDEST-ORF-mScarlet and pDEST-mScarlet-ORF gateway destination vectors, which were ligated into the pDEST-V2-ORF or pDEST-ORF-V2 backbones after PCR amplification (N-terminal primers: mScarlet_Nterm_F and mScarlet_Nterm_R, C-terminal primers: mScarlet_Cterm_F and mScarlet_Cterm_R) (Supplementary Table 4) and digested with ClaI/KpnI and ClaI/XbaI, respectively. All PCR reactions were performed using a high-fidelity DNA polymerase (Phusion II HS, F549S, Thermo Fisher), and all constructs were validated by analytical digests and sequencing and are available through Addgene (Supplementary Table 5).

For the pET28a-HaloTag-CNA35 construct, a HaloTag gene block (IDT) was digested with NheI/EcoRI and ligated into the similarly digested pET28a-EGFP-CNA35 backbone.

Phosphopeptide ELISA

Wells of a 96-well Nunc-Immuno plate (Nunc, 442404) were coated with streptavidin (overnight at 4 °C), then washed with 0.1% TBS-T before blocking with 5% BSA (1 h at 37 °C). Recombinant biotinylated peptide fragments of ITGB1 (Genscript; Bio-ITGB1_27aa_tail: NAKWDTGENPIYKSAVTTVVNPKYEGK or Bio-ITGB1Y783P_27aa_tail: NAKWDTGENPI[pY]KSAVTTVVNPKYEGK) were then added to wells and allowed to bind to the streptavidin coating for 1 h at room temperature. The plates were then washed 5× with 0.1% TBS-T before being treated for 30 min at 37 °C with recombinant Src (0.1 μg ml⁻¹; SignalChem, S19-10G-10), with/without ATP (20 μM), in kinase buffer (HEPES, pH 7.5 (60 mM)/MgCl₂ (5 mM)/DTT (1.25 mM)/MnCl₂ (5 mM)/Na₃VO₄ (3 μM)) as indicated. The phosphorylated tyrosine was then detected by first incubating with a pY primary antibody (PY20; 1:1,000, BD Biosciences, 610000) at room temperature and then with a horse radish peroxidase-conjugated anti-mouse secondary (1:2,000, Cell Signaling Technology, 7076) for 1 h at room temperature on a plate shaker (45 rpm). The plates were then washed three times with 0.1% TBS-T, 1-Step TMB (3,3′,5,5′ tetramethylbenzidine) and ELISA Substrate Solution (Thermo Fisher, 34028) was then added for 4 min before stopping the reaction with hydrogen peroxide (2 M) for 5 s per well and reading absorbance at 490 nm.

Polyacrylamide hydrogels

The in-house stiffness hydrogels were prepared as described previously⁷². Briefly, glass-bottom dishes (D35-14-1N, Cellvis) were treated with bind silane solution (71.4 μl bind silane ((3-(methacryloyloxy)propyl)trimethoxysilane; Sigma, M6514), Glacial acetic acid (71.4 μl; Sigma, 33209) up to 1 ml in ethanol (96%)) for 30 min at room temperature and then washed twice with ethanol (96%). A total of 12 μl of gel mixture (0.5 kPa: 63 μl 40% acrylamide solution (Sigma, A4058), 10 μl 2% Bis acrylamide solution (Sigma, M1533), 399 μl PBS, 2.5 μl 20% ammonium persulfate (Sigma, A3678, diluted in MilliQ water) and 1 μl TEMED (Sigma, T9281); 60 kPa: 225 μl 40% acrylamide solution, 100 μl 2% Bis acrylamide solution, 175 μl PBS, 2.5 μl 20% ammonium persulfate and 1 μl TEMED) was applied to the dry dish(es), gently placing 13 mm glass coverslips on top of the gel mixture, allowing it to set for 1 h at room temperature, as described previously^72,73. A sufficient amount of PBS was then added to completely cover the coverslip, before carefully removing the coverslip. Surface activation was performed with Sulfo-Sanpah (sulfosuccinimidyl 6-(4ammonium persulfate-azido-2ammonium persulfate-nitrophenylamino)hexanoate; 0.2 mg ml⁻¹ in 50 mM HEPES; Thermo Fisher Scientific, 22589) and N-ethyl-N′-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC; 2 mg ml⁻¹ in 50 mM HEPES; Sigma, 03450), applied to the gel surface for 30 min at room temperature with gentle agitation. The gels were then incubated in an ultraviolet oven (ultraviolet oven cleaner 342-220, Jelight Company) at 5 cm distance for 10 min, before washing three times with PBS and coating with 10 μg ml⁻¹ fibronectin (Millipore, 341631) and Collagen I (Millipore, 08-115), for a further 60 min at 37 °C.

Proliferation assays

To assess MM231 ITGB1(WT or YYFF) cancer cell proliferation, 2,000 cells per well were seeded in 3× parallel 96-well plates, and a single plate was analysed on each day of the assay using the cell counting kit-8 (Sigma, 96992), as per the manufacturer’s instructions. The relative cell density was measured from four wells per treatment condition by reading the absorbance at 450 nm after a 4 h incubation with the cell counting kit-8 reagent at 37 °C. Doubling times were obtained by fitting an exponential growth equation to the data using Prism 7 (GraphPad Software). Similarly, the IC₅₀ curves for Sara (SelleckChem, S1006) or SHP099 (SelleckChem, S8278) were performed for a panel of breast cancer cell lines by seeding 2,000 cells per 96-well plate and treating with serial dilutions of the inhibitors for 3 days, before using the cell counting kit-8 (Sigma, 96992) to detect relative cell density, as per the manufacturer’s instructions. The IC₅₀ curves were then calculated from normalized dose response curves in Prism 7 (GraphPad Software).

Recombinant protein purification

As described previously⁶⁵, BL21 competent Escherichia coli (NEB, C2530H) were transformed with the pET28a-HaloTag-CNA35 plasmid and grown overnight on a shaker at 37 °C to yield a 250 ml culture with an OD₆₀₀ = 0.6. This culture was then incubated with IPTG (500 μM; Thermo Fisher, R0392) on a shaker overnight at 30 °C. The bacteria were then pelleted by centrifugation at 6,000g for 15 min at 4 °C before discarding the supernatant and resuspending the pellet in 9 ml TBS with protease inhibitors (cOmplete Mini, EDTA-free, Roche). To this solution, 1 ml Bugbuster (Millipore, 10× protein extraction reagent, 70921-50ML), 1 µl Benzonase Nuclease (Sigma, E1014-5KU), 4.5 µl DNAse I (Sigma, 11284932001) and lysozyme from chicken egg white (Sigma, 62970) were added. This mixture was then rotated for 30 min at 4 °C before centrifugation at 6,000g for 1 h. The supernatant was then purified using a kit for His-tagged proteins (Macherey-Nagel, Protino Ni-TED2000 packed columns, 745120.25). The elution buffer was then exchanged against 4× changes of PBS using centrifugal filters (Millipore, Amicon Ultra-4, 10K UFC801024).

RNA isolation, complementary DNA generation and quantitative real-time PCR

The RNA from cultured cells was collected and isolated using the NucleoSpin RNA kit (Macherey-Nagel). The colonized mouse lungs, snap-frozen in liquid nitrogen, were homogenized with ceramic beads (Omni, SKU 19-627) and a bead Ruptor (Omni, SKU 25-010). RNA was isolated using a phenol-chloroform extraction method according to the manufacturer’s instructions (TRIsure, Bioline, BIO-32033). For cDNA synthesis, 1 µg of the extracted RNA was then used as a template for the high-capacity cDNA reverse transcription kit (Applied Biosystems). Each PCR reaction was performed using 100 ng cDNA and the appropriate Taqman gene expression assays (FAM; Thermo Fisher) for each gene, according to the manufacturer’s instructions (Thermo Fisher, TaqMan Fast Advanced Master Mix, 4444557). The following Taqman gene expression assays were used: Colfilin-2/CFL2 (Hs01071313_g1), Cofilin-1/CFL1 (Hs02621564_g1), Cortactin/CTTN (Hs01124232_m1), Tks5 (SH3PXD2A, (Hs01046307_m1), Dok1 (DOK1, Hs00796733_s1), EGFP (Mr04329676_mr), receptor-type tyrosine-protein phosphatase-like N/PTPRN (Hs00160947_m1), PTP-PEST/PTPN12 (Hs00184747_m1), myotubularin-related protein 8/MTMR8 (Hs00250307_m1), cell division cycle 14B/CDC14B (Hs00269351_m1), transmembrane phosphatase with tensin homology/TPTE (Hs00276201_m1), myotubularin/MTM1 (Hs00896975_m1), PTP non-receptor-type 20/PTPN20 (Hs00944181_m1), receptor-type tyrosine-protein phosphatase O/PTPRO (Hs00958177_m1), Slingshot homologue 2/SSH2 (Hs00987189_m1), dual-specificity phosphatase 8/DUSP8 (Hs01014943_m1), dual-specificity phosphatase 16/DUSP16 (Hs01015508_m1), dual-specificity phosphatase 3/DUSP3 (Hs01115776_m1) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)/GAPDH (Hs02786624_g1). The relative mRNA expression levels were normalized to GAPDH, and quantification was performed using the ΔΔCt method⁷⁴. To ascertain relative human cancer cell number in the mouse lung, human-specific GAPDH (Hs04420566_g1) levels, were normalized to GAPDH signal from primers with cross-reactivity to both mouse and human transcripts (Hs02786624_g1), as achieved previously⁷⁵.

SE-FRET microscopy

For the siRNA screen, MM231 cells with stable Illusia expression were seeded in 96-well plates, in which the PTP siRNA library (including three independent siRNAs/target) were first aliquoted in OptiMEM with RNAiMAX to a final concentration of 5 nM per siRNA per well. Incubating overnight, siRNA-transfected cells were split into two 96-well plates, where one was used for collecting RNA (as described above), and the other had a glass-bottom (high performance no. 1.5 cover glass, Cellviz, P96-1.5H-N) suitable for imaging applications. After 72 h, the cells in the glass-bottom plate were fixed with 4% PFA at 37 °C for 10 min. The plates were loaded by a plate handler (Twister II, Caliper) from ambient storage into a BD pathway 855 High-Content Analyzer (Beckton Dickinson) customized with high-power LEDs (Thorlabs SOLIS 445 and 565D), where they were sequentially imaged under control of iLinkPro 1.1 software. Images were acquired using a 20× N.A. 0.75 air objective (Olympus) together with 438/24 nm brightline (Semrock) or HQ500/20 nm (Chroma) excitation filters, 458 nm (Semrock) or 515 nm (Chroma 72100) dichroics and 483/32 nm (Semrock) or 542/27 nm emission filters. The LEDs were electronically shuttered through an optocoupler/double-inverter TTL circuit for precise exposure times and synchronization with camera acquisition⁷⁶. To calculate normalized FRET (NFRET), spectral bleed-through coefficients (BT_donor and BT_acceptor) were calculated using the FRET and Colocalization analyser⁷⁷ in Fiji with MM231 cells transfected with donor- (pEF.DEST51-mTurquoise) or acceptor-only (pEF.DEST51-YPet) controls using Lipofectamine 3000, as per the manufacturer’s instructions. These coefficients were then fed into the equation below to give the NFRET per cell⁷⁸, which were normalized for each replicate through conversion to robust z-scores using the stats package (v3.6.2) in RStudio (v2022.12.10). Outliers were removed using ROUT (Q = 0.1%) in Prism 7 (GraphPad Software),

$${{\mathrm{NFRET}}}=\frac{{I}_{{\mathrm{FRET}}}-\left({I}_{{\mathrm{donor}}}\times{{\mathrm{BT}}}_{{\mathrm{donor}}}\right)-\left({I}_{{\mathrm{acceptor}}}\times{{\mathrm{BT}}}_{{\mathrm{acceptor}}}\right)}{\sqrt{{I}_{{\mathrm{donor}}}\times{I}_{{\mathrm{acceptor}}}}}.$$

For the live imaging of cancer invasion, MM231 cells with stable Illusia expression were embedded inside 3D collagen I matrices with non-fluorescent TIFs, as described above. After 14 days of fibroblast-driven contraction, the matrices were cut to fit into eight-well Ibidi wells and imaged on a Zeiss LSM880 inverted confocal microscope using a 63×/0.75 Zeiss LD Plan-NEOFLUAR water immersion objective with 405 and 514 nm excitation, detecting simultaneously on PMT detectors for the donor (460–490 nm) and FRET/acceptor (520–540 nm) channels. NFRET was calculated as described above for each pixel of these images.

Statistics and reproducibility

The sample size for studies was chosen according to previous studies in the same area of research⁷⁹. Data collection and analysis were not performed blind to the conditions of the experiments. Prism 7 (GraphPad Software) was used for all statistical analyses, as indicated in the respective figure legends and the Statistical Source Data file. P values less than 0.05 were considered to be statistically significant. Individual data points per condition per replicate are shown, and n numbers are indicated in all figure legends, as appropriate. All micrographs (western blots and microscopy images) are representative of three or more independent experiments (n numbers are shown in the accompanying analyses for each micrograph). The original, uncropped western blots can be found in the Source data file for unprocessed western blots.

3D cell morphology assays

Illusia-expressing MM231 cells were embedded in a mixture of neutralized collagen I (2.5 ml collagen I acid-extracted rat tail homemade as described previously^16,65, 300 μl 10× minimum essential medium (Gibco, 21430020), 300 μl NaOH (0.22 mM) with 300 μl FBS containing the cells), incubated at 37 °C until set, then overlayed with growth medium containing DMSO, Sara (1 μM; SelleckChem, S1006) or SHP099 (100 nM; SelleckChem, S8278). The matrices were also spiked with Alexa647-labelled collagen I (1:1,000), labelled as described previously⁷². After 24 h, matrices were fixed in 4% PFA/PBS for 10 min at 37 °C and washed three times with PBS. The imaging was performed on a Zeiss 3i CSU-W1 spinning disk confocal microscope using SlideBook 6 acquisition software with a 63×/0.75 Zeiss LD Plan-NEOFLUAR objective with water immersion.

TIRF microscopy

Total internal reflection fluorescence (TIRF) imaging was performed using a Deltavision OMX SR microscope, with a 60× Olympus APO N TIRF objective after seeding cells in MatTek dishes (part no. P35G-1.5-7-C) for 6 h before fixation for 10 min at 37 °C with 4% PFA in PEM buffer (EGTA (10 mM; VWR Chemicals, 0732), MgSO₄ (1 mM; Fluka Analytical, 00627), PIPES (pH 6.9; 100 mM; Sigma, P6757), sucrose (75 mM; Sigma, S9378), Triton X-100 (0.2 %; Sigma, T8787) in H₂O). The samples were then blocked (2% BSA and glycine (1 M; PanReac AppliChem, A1067) in PBS) for 1 h at room temperature. The blocked samples were then stained with SiR-Actin (1 µM, Spirochrome, sc001), in parallel with primary antibodies against Paxillin ((Y113); 1:100, Abcam, ab32084) or active ITGB1 (clone 12G10; 1:25 from 0.25 mg ml⁻¹ stock; in-house production) in PBS overnight at 4 °C. The samples were then washed twice with PBS before staining with appropriate secondary antibodies for 1 h at room temperature, and a further two washes with PBS. Analysis of microscopy data was performed in Fiji (NIH), assessing colocalization using Pearson’s coefficients from the Coloc2 plugin. For live imaging of paxillin, MM231 cells with paxillin–EGFP were seeded in MatTek dishes overnight, treated with SHP099 (100 nM) or DMSO for 1 h.

Western blot

The protein lysates from cultured cell lines were prepared in TXLB lysis buffer (50 mM HEPES, 0.5% sodium deoxycholate, 0.1% SDS, 10 mM Na₃VO₄, 1% Triton X-100, 0.5 mM EDTA, 50 mM NaF, along with protease (cOmpleteTM Mini, EDTA-free, Roche) and phosphatase (PhosSTOP, Roche) inhibitor cocktails), adjusting volumes according to protein concentration (DC protein assay kit, Bio-Rad, 5000111). Gel electrophoresis was performed to separate proteins (Mini-PROTEAN TGX Precast Gels 4–20%, Bio-Rad, 4561096) that were then transferred onto a nitrocellulose membrane (Trans-Blot Turbo Transfer System, Bio-Rad) and blocked with AdvanBlock-Fluor (Advansta, R-03729-E10). The primary antibodies against ITGB1 (1:1,000, Abcam, ab52971), ITGB1(Y783) (1:500, Abcam, ab62337), PTP-PEST (1:1,000, Cell Signalling, 14735), Shp2 (1:1,000, Cell Signalling, 3397), Src (1:1,000, Cell Signalling, 2108), Src(Y416) (1:500, Cell Signalling, 2101), Arg (1:1,000, Abcam, ab134134), p130Cas (1:1,000, Santa Cruz, sc-20029), p130Cas(Y165) (1:1,000, Cell Signalling, 4015), p130Cas(Y410) (1:1,000, Cell Signalling, 4011), pY (1:1,000, BD Biosciences, 610000), GFP (1:1,000, Thermo Fisher, A11122), RFP (1:1,000; Chromotek, 6g6-100), Dok1 (1:1,000, Abcam, ab8112), VPS35 (1:1,000, Abcam, ab10099), Cofilin (D3F9; 1:1,000, Cell Signalling, 5175), Tks5 (1:500, Millipore, MABT336), β-Actin (1:10,000, Sigma, A1978), Cortactin (CTTN; clone 4F11; 1:500, Millipore, 05-180), annexin A6 (1:500, Abcam, ab31026) and GAPDH (1:10,000; Hytest, 5G4MAB6C5) were incubated overnight at 4 °C in AdvanBlock-Fluor. The membranes were washed between primary and secondary antibody treatments with TBS-T. IRDye secondary antibodies (Li-Cor, 1:5,000 diluted in TBS-T) were incubated for at least 1 h at room temperature, before detection on an Odyssey fluorescence imager CLx (Li-Cor). To assess broad inhibition of PTPs, sodium orthovanadate (${{\rm{VO}}}_{4}^{3-}$; activated, Calbiochem, 5 ml, 5086050004) was used. Densitometry analysis was performed in Fiji (NIH) by normalizing the signal to the GAPDH loading control.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

All data are available in the main text or the Supplementary Information. In addition, the mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE⁷⁹ partner repository with the dataset identifier PXD048646. The plasmids generated in this study are available through Addgene, as indicated in Supplementary Table 5, or by contacting one of the corresponding authors. All other data supporting the findings of this study are available from the corresponding author on reasonable request. Source data are provided with this study.

References

Chastney, M. R., Conway, J. R. W. & Ivaska, J. Integrin adhesion complexes. Curr. Biol. 31, R536–R542 (2021).
Article CAS PubMed Google Scholar
Stephens, L. E. et al. Deletion of beta-1 integrins in mice results in inner cell mass failure and periimplantation lethality. Gene Dev. 9, 1883–1895 (1995).
Article CAS PubMed Google Scholar
Fassler, R. et al. Lack of beta 1 integrin gene in embryonic stem cells affects morphology, adhesion, and migration but not integration into the inner cell mass of blastocysts. J. Cell Biol. 128, 979–988 (1995).
Article CAS PubMed Google Scholar
Meves, A., Stremmel, C., Bottcher, R. T. & Fassler, R. Beta 1 integrins with individually disrupted cytoplasmic NPxY motifs are embryonic lethal but partially active in the epidermis. J. Investig. Dermatol. 133, 2722–2731 (2013).
Article CAS PubMed Google Scholar
Czuchra, A., Meyer, H., Legate, K. R., Brakebusch, C. & Fassler, R. Genetic analysis of beta1 integrin “activation motifs” in mice. J. Cell Biol. 174, 889–899 (2006).
Article CAS PubMed PubMed Central Google Scholar
Chen, H. et al. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev. 20, 927–932 (2006).
Article CAS PubMed PubMed Central Google Scholar
Barrow-McGee, R. et al. Beta 1-integrin-c-Met cooperation reveals an inside-in survival signalling on autophagy-related endomembranes. Nat. Commun. 7, 11942 (2016).
Article CAS PubMed PubMed Central Google Scholar
Wennerberg, K. et al. The cytoplasmic tyrosines of integrin subunit beta1 are involved in focal adhesion kinase activation. Mol. Cell. Biol. 20, 5758–5765 (2000).
Article CAS PubMed PubMed Central Google Scholar
Meves, A. et al. Beta1 integrin cytoplasmic tyrosines promote skin tumorigenesis independent of their phosphorylation. Proc. Natl Acad. Sci. USA 108, 15213–15218 (2011).
Article CAS PubMed PubMed Central Google Scholar
Johansson, M. W., Larsson, E., Luning, B., Pasquale, E. B. & Ruoslahti, E. Altered localization and cytoplasmic domain-binding properties of tyrosine-phosphorylated beta 1 integrin. J. Cell Biol. 126, 1299–1309 (1994).
Article CAS PubMed Google Scholar
Anthis, N. J. et al. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J. Biol. Chem. 284, 36700–36710 (2009).
Article CAS PubMed PubMed Central Google Scholar
Conway, J. R. W. & Jacquemet, G. Cell matrix adhesion in cell migration. Essays Biochem. 63, 535–551 (2019).
Article CAS PubMed Google Scholar
Hamidi, H. & Ivaska, J. Every step of the way: integrins in cancer progression and metastasis. Nat. Rev. Cancer 18, 533–548 (2018).
Article CAS PubMed PubMed Central Google Scholar
Grzesiak, J. J. et al. Knockdown of the beta(1) integrin subunit reduces primary tumor growth and inhibits pancreatic cancer metastasis. Int. J. Cancer 129, 2905–2915 (2011).
Article CAS PubMed PubMed Central Google Scholar
Retta, S. F. et al. Cross talk between beta(1) and alpha(V) integrins: beta(1) affects beta(3) mRNA stability. Mol. Biol. Cell 12, 3126–3138 (2001).
Article CAS PubMed PubMed Central Google Scholar
Conway, J. R. W. et al. Three-dimensional organotypic matrices from alternative collagen sources as pre-clinical models for cell biology. Sci Rep. 7, 16887 (2017).
Article PubMed PubMed Central Google Scholar
Wang, Y. et al. Visualizing the mechanical activation of Src. Nature 434, 1040–1045 (2005).
Article CAS PubMed Google Scholar
Komatsu, N. et al. Development of an optimized backbone of FRET biosensors for kinases and GTPases. Mol Biol Cell 22, 4647–4656 (2011).
Article CAS PubMed PubMed Central Google Scholar
Kokko, Y. O. S. Pessi ja Illusia 3rd edn (Werner Söderström Oy, 1944).
Arias-Salgado, E. G. et al. Src kinase activation by direct interaction with the integrin beta cytoplasmic domain. Proc. Natl Acad. Sci. USA 100, 13298–13302 (2003).
Article CAS PubMed PubMed Central Google Scholar
Sakai, T., Jove, R., Fassler, R. & Mosher, D. F. Role of the cytoplasmic tyrosines of beta 1A integrins in transformation by v-src. Proc. Natl Acad. Sci. USA 98, 3808–3813 (2001).
Article CAS PubMed PubMed Central Google Scholar
Simpson, M. A. et al. Direct interactions with the integrin beta1 cytoplasmic tail activate the Abl2/Arg kinase. J. Biol. Chem. 290, 8360–8372 (2015).
Article CAS PubMed PubMed Central Google Scholar
Datta, A., Huber, F. & Boettiger, D. Phosphorylation of beta3 integrin controls ligand binding strength. J. Biol. Chem. 277, 3943–3949 (2002).
Article CAS PubMed Google Scholar
Alonso, A. et al. Protein tyrosine phosphatases in the human genome. Cell 117, 699–711 (2004).
Article CAS PubMed Google Scholar
Horton, E. R. et al. Definition of a consensus integrin adhesome and its dynamics during adhesion complex assembly and disassembly. Nat. Cell Biol. 17, 1577–1587 (2015).
Article CAS PubMed PubMed Central Google Scholar
Vainonen, J. P., Momeny, M. & Westermarck, J. Druggable cancer phosphatases. Sci. Transl. Med. 13, eabe2967 (2021).
Article CAS PubMed Google Scholar
Kechagia, J. Z., Ivaska, J. & Roca-Cusachs, P. Integrins as biomechanical sensors of the microenvironment. Nat. Rev. Mol. Cell Biol. 20, 457–473 (2019).
Article CAS PubMed Google Scholar
Guimarães, C. F., Gasperini, L., Marques, A. P. & Reis, R. L. The stiffness of living tissues and its implications for tissue engineering. Nat. Rev. Mater. 5, 351–370 (2020).
Article Google Scholar
Cox, T. R. & Erler, J. T. Remodeling and homeostasis of the extracellular matrix: implications for fibrotic diseases and cancer. Dis. Model Mech. 4, 165–178 (2011).
Article CAS PubMed PubMed Central Google Scholar
Murphy, K. J. et al. Intravital imaging technology guides FAK-mediated priming in pancreatic cancer precision medicine according to Merlin status. Sci. Adv. 7, eabh0363 (2021).
Article CAS PubMed PubMed Central Google Scholar
Jin, L. et al. Phosphorylation-mediated activation of LDHA promotes cancer cell invasion and tumour metastasis. Oncogene 36, 3797–3806 (2017).
Article CAS PubMed PubMed Central Google Scholar
Sarker, F. A., Prior, V. G., Bax, S. & O’Neill, G. M. Forcing a growth factor response—tissue-stiffness modulation of integrin signaling and crosstalk with growth factor receptors. J. Cell Sci. 133, jcs242461 (2020).
Article CAS PubMed Google Scholar
Glentis, A. et al. Cancer-associated fibroblasts induce metalloprotease-independent cancer cell invasion of the basement membrane. Nat. Commun. 8, 924 (2017).
Article PubMed PubMed Central Google Scholar
Croucher, D. R. et al. Bimolecular complementation affinity purification (BiCAP) reveals dimer-specific protein interactions for ERBB2 dimers. Sci. Signal 9, ra69 (2016).
Article PubMed Google Scholar
Bravo-Cordero, J. J., Magalhaes, M. A., Eddy, R. J., Hodgson, L. & Condeelis, J. Functions of cofilin in cell locomotion and invasion. Nat. Rev. Mol. Cell Biol. 14, 405–415 (2013).
Article CAS PubMed Google Scholar
Paz, H., Pathak, N. & Yang, J. Invading one step at a time: the role of invadopodia in tumor metastasis. Oncogene 33, 4193–4202 (2014).
Article CAS PubMed Google Scholar
Ngan, E. et al. LPP is a Src substrate required for invadopodia formation and efficient breast cancer lung metastasis. Nat. Commun. 8, 15059 (2017).
Article PubMed PubMed Central Google Scholar
Mader, C. C. et al. An EGFR-Src-Arg-cortactin pathway mediates functional maturation of invadopodia and breast cancer cell invasion. Cancer Res. 71, 1730–1741 (2011).
Article CAS PubMed PubMed Central Google Scholar
Artym, V. V., Zhang, Y., Seillier-Moiseiwitsch, F., Yamada, K. M. & Mueller, S. C. Dynamic interactions of cortactin and membrane type 1 matrix metalloproteinase at invadopodia: defining the stages of invadopodia formation and function. Cancer Res. 66, 3034–3043 (2006).
Article CAS PubMed Google Scholar
Oxley, C. L. et al. An integrin phosphorylation switch: the effect of beta3 integrin tail phosphorylation on Dok1 and talin binding. J. Biol. Chem. 283, 5420–5426 (2008).
Article CAS PubMed Google Scholar
Thery, M. et al. Anisotropy of cell adhesive microenvironment governs cell internal organization and orientation of polarity. Proc. Natl Acad. Sci. USA 103, 19771–19776 (2006).
Article CAS PubMed PubMed Central Google Scholar
Isomursu, A. et al. Dynamic micropatterning reveals substrate-dependent differences in the geometric control of cell polarization and migration. Small Methods 8, e2300719 (2024).
Article PubMed Google Scholar
Hartman, Z. R., Schaller, M. D. & Agazie, Y. M. The tyrosine phosphatase SHP2 regulates focal adhesion kinase to promote EGF-induced lamellipodia persistence and cell migration. Mol. Cancer Res. 11, 651–664 (2013).
Article CAS PubMed PubMed Central Google Scholar
Tseng, C. C. et al. Alpha-actinin-4 recruits Shp2 into focal adhesions to potentiate ROCK2 activation in podocytes. Life Sci. Alliance 5, e202201557 (2022).
Article CAS PubMed PubMed Central Google Scholar
Gelens, L. & Saurin, A. T. Exploring the function of dynamic phosphorylation–dephosphorylation cycles. Dev. Cell 44, 659–663 (2018).
Article CAS PubMed Google Scholar
Smith, M. J., Hardy, W. R., Murphy, J. M., Jones, N. & Pawson, T. Screening for PTB domain binding partners and ligand specificity using proteome-derived NPXY peptide arrays. Mol. Cell. Biol. 26, 8461–8474 (2006).
Article CAS PubMed PubMed Central Google Scholar
Prahallad, A. et al. CRISPR screening identifies mechanisms of resistance to KRASG12C and SHP2 inhibitor combinations in non-small cell lung cancer. Cancer Res. 83, 4130–4141 (2023).
Article PubMed PubMed Central Google Scholar
Pines, M., Fairchild, M. J. & Tanentzapf, G. Distinct regulatory mechanisms control integrin adhesive processes during tissue morphogenesis. Dev. Dyn. 240, 36–51 (2011).
Article CAS PubMed Google Scholar
Xu, X. et al. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev. Dyn. 239, 763–772 (2010).
Article CAS PubMed PubMed Central Google Scholar
Calderwood, D. A. et al. Integrin beta cytoplasmic domain interactions with phosphotyrosine-binding domains: a structural prototype for diversity in integrin signaling. Proc. Natl Acad. Sci. USA 100, 2272–2277 (2003).
Article CAS PubMed PubMed Central Google Scholar
Pelham, R. J. Jr. & Wang, Y. Cell locomotion and focal adhesions are regulated by substrate flexibility. Proc. Natl Acad. Sci. USA 94, 13661–13665 (1997).
Article CAS PubMed PubMed Central Google Scholar
Gu, Z. et al. Soft matrix is a natural stimulator for cellular invasiveness. Mol. Biol. Cell 25, 457–469 (2014).
Article PubMed PubMed Central Google Scholar
Wei, X. et al. TAGLN mediated stiffness-regulated ovarian cancer progression via RhoA/ROCK pathway. J. Exp. Clin. Cancer Res. 40, 292 (2021).
Article CAS PubMed PubMed Central Google Scholar
Hou, S. et al. Distinct effects of beta1 integrin on cell proliferation and cellular signaling in MDA-MB-231 breast cancer cells. Sci. Rep. 6, 18430 (2016).
Article CAS PubMed PubMed Central Google Scholar
White, D. E. et al. Targeted disruption of beta1-integrin in a transgenic mouse model of human breast cancer reveals an essential role in mammary tumor induction. Cancer Cell 6, 159–170 (2004).
Article CAS PubMed Google Scholar
Slack, R. J., Macdonald, S. J. F., Roper, J. A., Jenkins, R. G. & Hatley, R. J. D. Emerging therapeutic opportunities for integrin inhibitors. Nat. Rev. Drug Discov. 21, 60–78 (2022).
Article CAS PubMed Google Scholar
Zhang, S. et al. SRC family kinases as novel therapeutic targets to treat breast cancer brain metastases. Cancer Res. 73, 5764–5774 (2013).
Article CAS PubMed PubMed Central Google Scholar
Heilmann, T. et al. Dasatinib prevents skeletal metastasis of osteotropic MDA-MB-231 cells in a xenograft mouse model. Arch. Gynecol. Obstet. 301, 1493–1502 (2020).
Article CAS PubMed Google Scholar
Chen, H. et al. SHP2 is a multifunctional therapeutic target in drug resistant metastatic breast cancer. Oncogene 39, 7166–7180 (2020).
Article PubMed PubMed Central Google Scholar
Leong, H. S. et al. Invadopodia are required for cancer cell extravasation and are a therapeutic target for metastasis. Cell Rep. 8, 1558–1570 (2014).
Article CAS PubMed Google Scholar
Perentes, J. Y. et al. Cancer cell-associated MT1-MMP promotes blood vessel invasion and distant metastasis in triple-negative mammary tumors. Cancer Res. 71, 4527–4538 (2011).
Article CAS PubMed Google Scholar
Li, C. M. et al. Differential Tks5 isoform expression contributes to metastatic invasion of lung adenocarcinoma. Genes Dev. 27, 1557–1567 (2013).
Article CAS PubMed PubMed Central Google Scholar
Iizuka, S., Abdullah, C., Buschman, M. D., Diaz, B. & Courtneidge, S. A. The role of Tks adaptor proteins in invadopodia formation, growth and metastasis of melanoma. Oncotarget 7, 78473–78486 (2016).
Article PubMed PubMed Central Google Scholar
Bankhead, P. et al. QuPath: open source software for digital pathology image analysis. Sci. Rep. 7, 16878 (2017).
Article PubMed PubMed Central Google Scholar
Conway, J. R. W. et al. IGFBP2 secretion by mammary adipocytes limits breast cancer invasion. Sci. Adv. 9, eadg1840 (2023).
Article CAS PubMed PubMed Central Google Scholar
Harris, N. L. E. et al. SerpinB2 regulates stromal remodelling and local invasion in pancreatic cancer. Oncogene 36, 4288–4298 (2017).
Article CAS PubMed PubMed Central Google Scholar
Hoggatt, A. F., Hoggatt, J., Honerlaw, M. & Pelus, L. M. A spoonful of sugar helps the medicine go down: a novel technique to improve oral gavage in mice. J. Am. Assoc. Lab. Anim. Sci. 49, 329–334 (2010).
PubMed PubMed Central Google Scholar
Follain, G. et al. Using the zebrafish embryo to dissect the early steps of the metastasis cascade. Methods Mol. Biol. 1749, 195–211 (2018).
Article CAS PubMed Google Scholar
Munro, J., Steeghs, K., Morrison, V., Ireland, H. & Parkinson, E. K. Human fibroblast replicative senescence can occur in the absence of extensive cell division and short telomeres. Oncogene 20, 3541–3552 (2001).
Article CAS PubMed Google Scholar
Martin, K. H. et al. Quantitative measurement of invadopodia-mediated extracellular matrix proteolysis in single and multicellular contexts. J. Vis. Exp. e4119 (2012).
Parsons, M., Messent, A. J., Humphries, J. D., Deakin, N. O. & Humphries, M. J. Quantification of integrin receptor agonism by fluorescence lifetime imaging. J. Cell Sci. 121, 265–271 (2008).
Article CAS PubMed Google Scholar
Conway, J. R. W. et al. Defined extracellular matrix compositions support stiffness-insensitive cell spreading and adhesion signaling. Proc. Natl Acad. Sci. USA 120, e2304288120 (2023).
Article CAS PubMed PubMed Central Google Scholar
Barber-Perez, N. et al. Mechano-responsiveness of fibrillar adhesions on stiffness-gradient gels. J. Cell Sci. 133, jcs242909 (2020).
Article CAS PubMed PubMed Central Google Scholar
Schmittgen, T. D. & Livak, K. J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108 (2008).
Article CAS PubMed Google Scholar
Dahn, M. L., Dean, C. A., Jo, D. B., Coyle, K. M. & Marcato, P. Human-specific GAPDH qRT-PCR is an accurate and sensitive method of xenograft metastasis quantification. Mol. Ther. Methods Clin. Dev. 20, 398–408 (2021).
Article CAS PubMed Google Scholar
Li, L. L. et al. Resonance energy transfer sensitises and monitors in situ switching of LOV2-based optogenetic actuators. Nat. Commun. 11, 5107 (2020).
Article CAS PubMed PubMed Central Google Scholar
Hachet-Haas, M. et al. FRET and colocalization analyzer-a method to validate measurements of sensitized emission FRET acquired by confocal microscopy and available as an ImageJ Plug-in. Microsc. Res. Tech. 69, 941–956 (2006).
Article CAS PubMed Google Scholar
Feige, J. N., Sage, D., Wahli, W., Desvergne, B. & Gelman, L. PixFRET, an ImageJ plug-in for FRET calculation that can accommodate variations in spectral bleed-throughs. Microsc. Res. Tech. 68, 51–58 (2005).
Article CAS PubMed Google Scholar
Perez-Riverol, Y. et al. The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 50, D543–D552 (2022).
Article CAS PubMed Google Scholar

Download references

Acknowledgements

We thank P. Laasola, J. Siivonen and R. Mahran for technical assistance and the Ivaska lab for scientific discussion and feedback on the manuscript. We also thank N. Pasquier, A. Isomursu and M. Mathieu for providing necessary reagents for the completion of the study, and for critical reading, we thank H. Hamidi. For support with applying the basement membrane invasion assay, we thank R. Staneva and D. Vignjevic (Institut Curie, Paris, France). For services, instrumentation and expertise at Turku Bioscience (University of Turku, Turku, Finland), we thank the Cell Imaging and Cytometry Core, the Turku Proteomics Facility and the Genome Editing Core, all supported by Biocenter Finland. We also thank the Turku Screening Unit lab automation site, part of the DDCB platform supported by Biocenter Finland, for services, instrumentation and expertise. The clone pENTR223-SH3PXD2A was from the ORFeome library at the Genome Biology Unit core facility, supported by HiLIFE and the Faculty of Medicine, University of Helsinki, and Biocenter Finland. The histological methods were performed by the Histology core facility of the Institute of Biomedicine, University of Turku, Finland. This work was supported by the Finnish Cancer Institute (K. Albin Johansson Professorship to J.I.); a Research Council of Finland research project (grant no. 325464 to J.I.) and Centre of Excellence programme (grant nos. 346131 and 364182 to J.I.); the Cancer Foundation Finland (to J.I.); the Sigrid Juselius Foundation (to J.I.); and the Research Council of Finland InFLAMES Flagship Programme (grant nos. 337530 and 357910). J.R.W.C. was supported by the European Union’s Horizon 2020 research and innovation programme under the Marie Sklodowska-Curie grant agreement (grant no. 841973), a Research Council of Finland postdoctoral research grant (grant no. 338585) and Research Fellowship (grant no. 360775). G.F. was supported by a Research Council of Finland postdoctoral research grant (grant no. 332402) and the Turku Collegium for Science, Medicine and Technology. M.G. was supported by a Worldwide Cancer Research grant (no. 23-0123 to J.I.).

Funding

Open Access funding provided by University of Turku (including Turku University Central Hospital).

Author information

James R. W. Conway
Present address: Department of Biochemistry and Developmental Biology, Faculty of Medicine, University of Helsinki, Helsinki, Finland

Authors and Affiliations

Turku Bioscience Centre, University of Turku and Åbo Akademi University, Turku, Finland
James R. W. Conway, Omkar Joshi, Jasmin Kaivola, Gautier Follain, Michalis Gounis, David Kühl & Johanna Ivaska
Faculty of Science and Engineering, Cell Biology, Åbo Akademi University, Turku, Finland
Gautier Follain
Turku Collegium for Science, Medicine and Technology TCSMT, University of Turku, Turku, Finland
Gautier Follain
Department of Life Technologies, University of Turku, Turku, Finland
Johanna Ivaska
InFLAMES Research Flagship Center, University of Turku, Turku, Finland
Johanna Ivaska
Western Finnish Cancer Center, University of Turku, Turku, Finland
Johanna Ivaska
Foundation for the Finnish Cancer Institute, Helsinki, Finland
Johanna Ivaska

Authors

James R. W. Conway
View author publications
Search author on:PubMed Google Scholar
Omkar Joshi
View author publications
Search author on:PubMed Google Scholar
Jasmin Kaivola
View author publications
Search author on:PubMed Google Scholar
Gautier Follain
View author publications
Search author on:PubMed Google Scholar
Michalis Gounis
View author publications
Search author on:PubMed Google Scholar
David Kühl
View author publications
Search author on:PubMed Google Scholar
Johanna Ivaska
View author publications
Search author on:PubMed Google Scholar

Contributions

J.R.W.C., J.K., O.J., J.K., G.F., M.G. and D.K. performed the experiments and analysed the data. J.R.W.C. and J.I. wrote the paper. All authors commented on the manuscript and approved the final version.

Corresponding authors

Correspondence to James R. W. Conway or Johanna Ivaska.

Ethics declarations

Competing interests

The authors declare no competing interests.

Peer review

Peer review information

Nature Cell Biology thanks the anonymous reviewers for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Extended data

Extended Data Fig. 1 Mutation of the ITGB1 NPxY tyrosine (Y) residues to non-phosphorylatable phenylalanine (F) does not change surface integrin levels, or cancer cell proliferation.

a, Representative western blot (left) and densitometry (right) of ITGB1 levels after shRNA-mediated KD in MM231 cells (shβ1; n = 3 biological replicates; significance assessed using a one-sample two-tailed t-test against the normalised control value; ***p < 0.001). Data are mean ± s.e.m. b & c, Representative curves (b) and doubling times (c) from the relative cell density of parental and shβ1 MM231 cells, and shβ1 MM231s with stable ITGB1(WT or YYFF) reexpression (ITGB1(WT or YYFF)-mRuby2 transposon vectors, described in methods; n = 3 biological replicates; significance assessed using a one-way ANOVA with a Šidák correction for multiple comparisons; NS, not significant). d, Gating strategy for the flow cytometry data presented in e & f. e & f, Representative histograms (e) and quantification (f) of the surface expression of total ITGB1 (P5D2), inactive ITGB1 (mAb13) and total integrin β3 (MCA728) using flow cytometry in shβ1 MM231s with or without ITGB1 reexpression as indicated (n = 4 biological replicates; significance assessed using a one-way ANOVA with a Tukey correction for multiple comparisons; NS, not significant; ^***p < 0.001). g & h, TIRF images (g) of MM231 shβ1 cells with ITGB1 WT or YYFF reexpression (cells outlined with pink dashed lines) and quantification of colocalization (h) between active integrin staining (12G10 antibody) and either mRuby2-tagged ITGB1 WT (average Pearson’s r of 0.4853) or YYFF (average Pearson’s r of 0.5012; n = 65 [ITGB1 (WT)] and 63 [ITGB1(YYFF)] cells pooled from three biological replicates; significance assessed using an unpaired two-tailed Student’s t-test with a Welch’s correction; NS, not significant). i, Analysis of paxillin staining in MM231 cells from (g) to compare IAC average number and size per cell (n = 87 [ITGB1 (WT)] and 85 [ITGB1 (YYFF)] cells pooled from four biological replicates; NS, not significant). j, Representative images of invading MM231 ITGB1(WT or YYFF) cells (left) and quantification of their proliferation (right) from the fibroblast-contracted 3D collagen I invasion assays in Fig. 1c. Cells are stained with the proliferation marker Ki67. Quantification was achieved by normalising the number of Ki67-positive nuclei to the total number of cells/region (n = 24 regions for each cell line pooled from three biological replicates; significance assessed using an unpaired two-tailed Student’s t-test with a Welch’s correction; NS, not significant). Scale bars, 100 μm. k, Representative images (left) and quantification (right) of Ki67-stained subcutaneous xenografts of MM231 cells with either ITGB1(WT or YYFF) from Fig. 1e. Quantification of positive (brown) to negative (blue) staining of Ki67 in 400 μm² regions of interest from subcutaneous xenografts is shown (n = 9 mice (WT) or 11 mice (YYFF); 5 regions/mouse/condition); significance assessed using an unpaired two-tailed Student’s t-test with a Welch’s correction; NS, not significant). Scale bars, 50 μm. Source data and exact p-values are provided in the statistical source data file. Boxplots represent median and interquartile range. Whiskers extend to min and max values. Grey areas on boxplots highlight the IQR of the control conditions.

Source data

Extended Data Fig. 2 Arg (ABL2) phosphorylates the ITGB1 NPxY sites.

a, Representative western blots of MM231 and MCF10A cells expressing either Venus or Dok1 (n = 4 biological replicates). b, A schematic of the intermolecular FRET approach between Dok1 and ITGB1 (WT or YYFF). c, Representative FLIM-FRET images (left) and quantification of apparent FRET efficiency (right) from MM231 shβ1 cells reexpressing mRuby2-tagged ITGB1(WT or YYFF) and transfected with Dok1-Clover (n = 60 cells in each condition pooled from three biological replicates; significance assessed using an unpaired two-tailed Student’s t-test with a Welch’s correction; ^***p < 0.001). Scale bars, 10 μm. d, Representative FLIM-FRET images (left) and quantification of apparent FRET efficiency (right) from MM231 shβ1 cells reexpressing mRuby2-tagged ITGB1(WT or YYFF), and transfected with GFP-F₀F₃ talin head domain fragment (n = 62 cells in each condition pooled from three biological replicates; significance assessed using an unpaired two-tailed Student’s t-test with a Welch’s correction; ^***p < 0.001). Scale bars, 20 μm. e & f, Apparent FRET efficiencies (e) and representative images (f) of MM231 cells stably expressing Illusia and Dox-inducible ABL2(WT) or kinase-dead ABL2(K281M) ± Dox treatment. Parental cells treated with Dox are used as an additional control (n = 60 cells in each condition pooled from three biological replicates; significance assessed using a one-way ANOVA with a Šidák correction for multiple comparisons; NS, not significant, ^***p < 0.001). Scale bars, 10 μm. g & h, Representative western blot (g) and densitometry (h) analysis of ITGB1 phosphorylation levels in MM231 cells with Dox-induced ABL2(WT) or ABL2(K281M) overexpression (n = 5 biological replicates; significance assessed using a one-sample two-tailed t-test against the normalised control values for each cell line without Dox; NS, not significant, ^*p < 0.05). Data are mean ± SEM. i & j, Representative western blot (i) and densitometry (j) of MM231 cells treated with saracatenib (Sara) for 0, 2, 24, 48 and 72 h (1 μM; n = 5 biological replicates; significance assessed using a one-sample two-tailed t-test against the normalised DMSO control). Source data and exact p-values are provided in the statistical source data file. Boxplots represent median and interquartile range. Whiskers extend to min and max values. Grey areas on boxplots highlight the interquartile range of the control conditions.

Source data

Extended Data Fig. 3 Validation of the phosphorylation-dependent changes of Illusia and the active dephosphorylation of ITGB1 in cancer and normal cells.

a & b, Representative immunoprecipitation (IP) of phosphorylated ITGB1 in MM231 (a) and TIF (b) cells using anti-pY beads after ${{\rm{VO}}}_{4}^{3-}$ treatment (100 mM, 2 h; n = 3 biological replicates). c, Representative western blot and densitometry analysis of ITGB1 phosphorylation levels in TIF cells after ${{\rm{VO}}}_{4}^{3-}$ treatment (100 mM, 2 h; n = 4 biological replicates; significance assessed using a one-sample two-tailed t-test against the normalised control value without ${{\rm{VO}}}_{4}^{3-}$; ^**p < 0.01). Data are mean ± SEM. d, Representative images (left) and quantification of apparent FRET efficiency (right) of VO₄^3- (100 mM, 2 h) treated TIF cells stably expressing Illusia (WT), or a non-phosphorylatable mutant (YYFF) (n = 60 cells in each condition pooled from three biological replicates; significance assessed using a one-way ANOVA with a Šidák correction for multiple comparisons; NS, not significant, ^***p < 0.001). Scale bars, 10 μm. e, Representative FLIM-FRET images (left) and apparent FRET efficiencies (right) from HEK293 cells transfected with different Illusia variants (WT, Y783F, Y795F, YYFF and YYEE; n = 127 [WT ${(-){\rm{VO}}}_{4}^{3-}$], 152 [WT ${(+){\rm{VO}}}_{4}^{3-}$], 113 [Y783F ${(-){\rm{VO}}}_{4}^{3-}$], 120 [Y783F ${(+){\rm{VO}}}_{4}^{3-}$], 109 [Y795F ${(-){\rm{VO}}}_{4}^{3-}$], 117 [Y795F ${(+){\rm{VO}}}_{4}^{3-}$], 115 [YYFF ${(-){\rm{VO}}}_{4}^{3-}$], 121 [YYFF ${(+){\rm{VO}}}_{4}^{3-}$], 106 [YYEE ${(-){\rm{VO}}}_{4}^{3-}$], and 109 [YYEE ${(+){\rm{VO}}}_{4}^{3-}$] cells pooled from four biological replicates; significance assessed using one-way ANOVA with a Šidák correction for multiple comparisons; NS, not significant, ***p < 0.001). Scale bars, 20 μm. f & g, Representative western blots of MM231 and TIF cells stably expressing Illusia and treated with ${{\rm{VO}}}_{4}^{3-}$ (f; 100 mM, 2 h; n = 3 biological replicates) or Sara for 24 h (g; 1 μM; n = 4 biological replicates). h, Representative GFP-trap IP of mT2 or Illusia from MM231 cells stably expressing the reported constructs (n = 3 biological replicates). Source data and exact p-values are provided in the statistical source data file. Boxplots represent median and interquartile range. Whiskers extend to min and max values. Grey areas on boxplots highlight the interquartile range of the control conditions.

Source data

Extended Data Fig. 4 Validation of siRNA knock-down of a subset of hits that showed significant changes in the Illusia FRET screen.

a & b, Representative images (a; Scale bars, 50 μm) and quantification of reverse transfections in MM231 and TIF cells using an siRNA against GFP; actin staining (SiR-Actin, magenta) and Illusia (Green) (UTC, untransfected control; siNTC, non-targeting control siRNA) (MM231s, n = 220 (UTC), 70 (siNTC), 122 (0 nM), 140 (1 nM), 79 (5 nM), 89 (25 nM), 117 (50 nM) and 98 (100 nM) | TIFs, n = 179 (UTC), 155 (siNTC), 174 (0 nM), 183 (1 nM), 224 (5 nM), 199 (25 nM), 118 (50 nM) and 198 (100 nM) cells pooled from three biological replicates; significance assessed using a one-way ANOVA with a Dunnett’s correction for multiple comparisons; NS, not significant, ***p < 0.001). Data are mean ± SEM. c, Parallel qRT-PCR from RNA samples collected from the RNAi FRET screen cells targeting the top 16 hits (n = 1 experiment, assessed in triplicate). ND, Not detected. d, Representative SE-FRET images of MM231s stably-expressing Illusia showing the normalised FRET (NFRET) from the untransfected controls with or without VO₄^3-, and siRNAs targeting PTPN11 and PTPN12, against the NTC siRNA. Scale bars, 20 µm. e & f, Representative western blots validating siRNA KD efficiency and ITGB1 phosphorylation levels in MM231 (left; n = 5 biological replicates; densitometry for ITGB1(Y783)/ITGB1 is displayed here. Densitometry for Shp2/GAPDH is in Fig. 4e) and TIF (right; n = 6 biological replicates; densitometry for ITGB1(Y783)/ITGB1 is displayed here. Densitometry for Shp2/GAPDH is in Fig. 4f) cells transfected with three different siRNAs (A, B and C) against PTPN11 (e) or PTPN12 (f). Source data and exact p-values are provided in the statistical source data file.

Source data

Extended Data Fig. 5 Inhibition or overexpression of Shp2 or PTP-PEST modulates ITGB1 phosphorylation.

a, Schematic of the FRET experiment (left), with representative FLIM-FRET images (middle) and quantification of apparent FRET efficiency (right) of MM231 cells with stable expression of either ITGB1(WT)-mRuby2 or ITGB1(YYFF)-mRuby2 transfected with Clover and treated with VO₄^3- (n = 65 [ITGB1(WT) ${(-){\rm{VO}}}_{4}^{3-}$], 70 [ITGB1(WT) ${(+){\rm{VO}}}_{4}^{3-}$], 72 [ITGB1(YYFF) ${(-){\rm{VO}}}_{4}^{3-}$], and 66 [ITGB1(YYFF) ${(+){\rm{VO}}}_{4}^{3-}$]) cells pooled from three biological replicates. Scale bars, 20 μm. b, Representative FLIM-FRET images (left) and quantification of apparent FRET efficiency (right) in MM231 cells with stable Illusia expression and constitutive overexpression of PTPN11 (Shp2, WT) or a phosphatase-dead mutant (Shp2, Mut; PTPN11(D425A, C459S)) (n = 97 (mScarlet), 96 (WT) and 96 (Mut) cells pooled from four biological replicates; significance assessed using a one-way ANOVA with a Tukey correction for multiple comparisons; NS, not significant, ^***p < 0.001). Scale bars, 20 μm. c, Representative western blot (left) and densitometry (right) of MM231 cells with stable Illusia expression and constitutive overexpression of PTPN11 (Shp2, WT) or a phosphatase-dead mutant (Shp2, Mut; PTPN11(D425A, C459S); n = 8 biological replicates; significance assessed using a one-sample two-tailed t-test against the normalised control value; ^*p < 0.05, ***p < 0.001; NS, not significant). d-e, Representative FLIM-FRET images (d) and quantification of apparent FRET efficiency (e) of MM231 cells with stable Illusia expression treated overnight with Dox to induce overexpression of PTP-PEST WT or a phosphatase-dead mutant (Mut, PTPN12(D199A, C231S) (n = 100 cells in each condition pooled from four biological replicates; significance assessed using a one-way ANOVA with a Šidák correction for multiple comparisons; NS, not significant, ^***p < 0.001). Scale bars, 20 μm. f, Western blot (left) and densitometry (right) from parallel data in (d; n = 4 biological replicates; significance assessed using a one-sample two-tailed t-test against the normalised control value; ^*p < 0.05; NS, not significant). g & h, Representative FLIM-FRET images (left) and quantification of apparent FRET efficiency (right) of MM231 (g) and TIF (h) cells with stable Illusia expression and treated with SHP099 for 2 h (100 nM) (MM231, n = 96 (DMSO) and 95 (SHP099) | TIFs, n = 100 (DMSO) and 99 (SHP099) cells pooled from four biological replicates; significance assessed using an unpaired two-tailed Student’s t-test with a Welch’s correction (NS, not significant, ^***p < 0.001). Scale bars, 20 μm. i, Representative western blots (left) and densitometry (right) of MM231 and TIF cells with stable Illusia expression and treated with SHP099 for 2 h (100 nM; n = 6 biological replicates; significance assessed using a one-sample two-tailed t-test against the normalised control value; ^*p < 0.05). Data are mean ± SEM. Source data and exact p-values are provided in the statistical source data file. Boxplots represent median and interquartile range. Whiskers extend to min and max values. Grey areas on boxplots highlight the interquartile range of the control conditions.

Source data

Extended Data Fig. 6 Inhibition of Src or Shp2 reduces breast cancer invasion and IAC lifetime.

a, IC50 curves for human HCC1937, MM231, MDA-MB-361, MM468 and BT-20 cells treated with increasing concentrations of either Sara or SHP099 (n = 3 biological replicates; 6 wells analysed per treatment per cell line for each replicate). Dotted lines indicate concentrations used for later experiments in the article. Data are presented as mean values +/- SEM. b, Representative images (left) of MM231 ITGB1(WT or YYFF) cell invasion into 3D fibroblast-contracted collagen I in the presence of DMSO or Sara (1 μM), stained with pan-cytokeratin (PanCK) to exclude fibroblasts from the analysis. Quantification (right) of invasion beyond 100 μm, normalised to the total number of cells/region, or proliferation, normalising the number of Ki67-positive nuclei to the total number of cells/region (ITGB1(WT), n = 32 (DMSO) and 32 (Sara) | ITGB1(YYFF), n = 32 (DMSO) and 30 (Sara) regions pooled from four biological replicates; significance assessed using an unpaired two-tailed Student’s t-test with Welch’s correction; NS, not significant, ^***p < 0.001). Scale bars, 100 μm. c, MM231 cells stably expressing paxillin-EGFP imaged on OMX TIRF for 30 min in the presence of SHP099 (100 nM) or DMSO control (n = 26 (DMSO) and 21 (SHP099) cells pooled from three biological replicates; significance assessed using a one-way ANOVA with a Tukey correction for multiple comparisons; *p < 0.05). d, Representative images of Illusia-expressing MM231 cells embedded in 3D collagen matrices and treated with DMSO or either SHP099 (100 nM) or Sara (1 μM; n = 3 biological replicates; 3-8 movies/replicate/condition). Scale bars, 20 μm. e, Illusia-expressing MM231 cells treated overnight with Sara (1 μM) or SHP099 (100 nM) and imaged for changes in FRET by sensitised emission (SE-FRET) on a confocal microscope (n = 30 (DMSO), 29 (Sara) and 27 (SHP099) fields of view pooled from three biological replicates; significance assessed using a one-way ANOVA with a Dunnett’s correction for multiple comparisons; ^**p < 0.01, not significant, ^***p < 0.001). Scale bars, 10 μm. Source data and exact p-values are provided in the statistical source data file. Boxplots represent median and interquartile range. Whiskers extend to min and max values. Grey areas on boxplots highlight the interquartile range of the control conditions.

Source data

Extended Data Fig. 7 Cofilin, VPS35 and Annexin A6 are recruited to the phosphorylated Dok1/ITGB1 complex.

a, Representative BiFC-FLIM-FRET images (left) and quantification of apparent FRET efficiency (right) from MM231 cells transfected with Venus or ITGB1-V1/ Dok1-V2 and either mScarlet-tagged Annexin A6 or VPS35 (n = 61 for each Annexin A6 condition, 58 (VPS35, Venus) and 60 (VPS35, BiFC) cells pooled from three biological replicates; significance assessed using an unpaired two-tailed Student’s t-test with a Welch’s correction; ^***p < 0.001). Scale bars, 20 μm. b, Schematic of an invadopodium degrading the ECM. c, Representative images (left) and quantification (right) of MM231 ITGB1(WT or YYFF) cells with doxycycline(Dox)-inducible Src(E378G), treated (+/-)Dox overnight and then seeded on fluorescent gelatin (green) for 6 h (white, SiR-Actin stain; blue, DAPI nuclear stain; n = 30 [ITGB1 (WT) (-)Dox], 41 [ITGB1 (WT) ( + )Dox], 34 [ITGB1(YYFF) (-)Dox] and 41 [ITGB1(YYFF) ( + )Dox] fields of view pooled from three biological replicates; significance assessed using a one-way ANOVA with a Šidák correction for multiple comparisons; NS, not significant, ^***p < 0.001). Scale bars, 20 μm. Source data and exact p-values are provided in the statistical source data file. Boxplots represent median and interquartile range. Whiskers extend to min and max values. Grey areas on boxplots highlight the interquartile range of the control conditions.

Source data

Extended Data Fig. 8 Expression of invadopodia components is co-regulated at the protein level.

a, Representative immunoblot from MM231 ITGB1 (WT or YYFF) cells and doxycycline (Dox)-inducible Src(E378G) transfected with siRNAs against Dok1, treated with Dox for 24 h and blotted for Cofilin, TKS5, CTTN and Dok1. b, X-Y correlation plots from densitometric analysis of western blots in (a), normalising to the actin loading control for Cofilin, TKS5, CTTN and Dok1. Plotted are graphs showing correlations between Dok1-Cofilin (left), Dok1-TKS5 (middle) and Dok1-CTTN (right; n = 7 biological replicates; significance assessed using an X-Y linear regression). c, qPCR data from MM231 cells transfected with siRNAs against DOK1 (siDok1_1 and siDok1_2), or a NTC (siNTC), and treated with Dox for 24 h before processing for qRT-PCR. Plotted is the relative mRNA fold-change, normalised to GAPDH (n = 4 biological replicates, performed in duplicate or triplicate; significance assessed using a one sample t-test against the normalised siNTC control values; NS, not significant, ^***p < 0.001, ^**p < 0.01, ^*p < 0.05). d, Schematic of luciferase/EGFP construct (top) and qRT-PCR (bottom) for EGFP fold-change between the MM231 ITGB1(WT or YYFF) cells stably-expressing the luciferase/EGFP construct, normalised to GAPDH (n = 4 biological replicates, performed in triplicate; significance assessed using a one-sample two-tailed t-test against the normalised control values; NS, not significant). e, Representative images of mice immediately after lateral tail vein injection with MM231 ITGB1(WT or YYFF) cells stably-expressing the luciferase/EGFP construct and pre-treated with either DMSO or SHP099 (100 nM). Oral gavage of Vehicle or SHP099 (100 mg/kg) proceeded for 5 days from the day of injection. f, Quantification of the average (avg) radiance from the luciferase signal during the colonisation stages of the MM231 cells (n = 9 mice tracked/group; mean ± SEM). g, Quantification of metastatic area (%) in lungs from EGFP-positive MM231 cells (n = 10 mice/group; scatter plot with a line at the median value). h, Assessment of the ratio of micro- to macrometastasis in lungs from clusters of EGFP-positive MM231 cells lesser or greater than 3,000 µm² respectively; excluding mice where no micro- or macrometastasis were detected (n = 9, 8 & 7 mice for the WT/vehicle, WT/SHP099 and YYFF/vehicle groups respectively; scatter plot with a line at the median value). i & j, Gating strategy (i) and flow cytometric analysis (j) of annexinV-stained MM231s with ITGB1(WT or YYFF) and treated with either DMSO or SHP099 (SHP; 100 nM) while grown overnight in suspension on ultra-low attachment plates and either subjected to flow and/or treated with SHP099 (100 nM) or DMSO control (negative (-ve): unstained negative control samples; positive ( + ve): MM231s treated with a cell-death-inducing cocktail of doxorubicin (10 µg/ml), ${{\rm{VO}}}_{4}^{3-}$ (50 µM), gemcitabine (10 µM); n = 4 biological replicates/cell line for DMSO and SHP099 “No flow” and n = 3 biological replicates for all other conditions; mean ± SEM; Statistics from a one-way ANOVA with a Tukey correction for multiple comparisons; NS, not significant). Source data and exact p-values are provided in the statistical source data file. Boxplots represent median and interquartile range. Whiskers extend to min and max values.

Source data

Supplementary information

Reporting Summary

Peer Review File

Supplementary Video 1

Supplementary Video 1. Representative timelapses using TIRF microscopy to track IAC dynamics in MM231 cells stably expressing paxillin–EGFP, treated with DMSO or SHP099 (100 nM; scale bar, 5 μm).

Supplementary Video 2

Supplementary Video 2. SE-FRET imaging of MM231 cells embedded in 3D collagen matrices and treated with DMSO, Sara (1 μM) or SHP099 (100 nM; scale bar, 10 μm).

Supplementary Tables

Supplementary Tables 1–5.

Source data

Source Data Fig. 1

Statistical source data.

Source Data Fig. 2

Statistical source data.

Source Data Fig. 2

Unprocessed western blots and/or gels.

Source Data Fig. 3

Statistical source data.

Source Data Fig. 3

Unprocessed western blots and/or gels.

Source Data Fig. 4

Statistical source data.

Source Data Fig. 5

Statistical source data.

Source Data Fig. 6

Statistical source data.

Source Data Fig. 7

Statistical source data.

Source Data Fig. 7

Unprocessed western blots and/or gels.

Source Data Fig. 8

Statistical source data.

Source Data Extended Data Fig. 1

Statistical source data.

Source Data Extended Data Fig. 1

Unprocessed western blots and/or gels.

Source Data Extended Data Fig. 2

Statistical source data.

Source Data Extended Data Fig. 2

Unprocessed western blots and/or gels.

Source Data Extended Data Fig. 3

Statistical source data.

Source Data Extended Data Fig. 3

Unprocessed western blots and/or gels.

Source Data Extended Data Fig. 4

Statistical source data.

Source Data Extended Data Fig. 4

Unprocessed western blots and/or gels.

Source Data Extended Data Fig. 5

Statistical source data.

Source Data Extended Data Fig. 5

Unprocessed western blots and/or gels.

Source Data Extended Data Fig. 6

Statistical source data.

Source Data Extended Data Fig. 7

Statistical source data.

Source Data Extended Data Fig. 8

Statistical source data.

Source Data Extended Data Fig. 8

Unprocessed western blots and/or gels.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Conway, J.R.W., Joshi, O., Kaivola, J. et al. Dynamic regulation of integrin β1 phosphorylation supports invasion of breast cancer cells. Nat Cell Biol 27, 1021–1034 (2025). https://doi.org/10.1038/s41556-025-01663-4

Download citation

Received: 01 March 2024
Accepted: 26 March 2025
Published: 26 May 2025
Issue date: June 2025
DOI: https://doi.org/10.1038/s41556-025-01663-4

Subjects

Abstract

Similar content being viewed by others

Main

Results

Integrin phosphorylation directs breast cancer cell invasion

Generation of the first integrin phosphorylation reporter

Illusia demonstrates direct Src phosphorylation of ITGB1

ITGB1 is actively dephosphorylated by PTPs

A high-content siRNA screen identifies putative ITGB1 PTPs

Shp2 and PTP-PEST are direct PTPs for ITGB1

Disrupting ITGB1 phosphorylation reduces cell invasion

Cofilin is recruited to the phosphorylated ITGB1/Dok1 complex

Dynamic ITGB1 phosphorylation supports invadopodia formation

Dynamic ITGB1 phosphorylation supports metastasis

Discussion

Methods

Animal experiments

Anoikis assays

Basement membrane invasion assays

BiCAP mass spectrometry

Cell line models

FLIM–FRET microscopy

Flow cytometry

Gene silencing

Generation of stable cell lines

IP

Immunohistochemistry

Invadopodia imaging

Invasion into fibroblast-contracted 3D collagen I matrices

Malachite green phosphate detection

Molecular cloning

Phosphopeptide ELISA

Polyacrylamide hydrogels

Proliferation assays

Recombinant protein purification

RNA isolation, complementary DNA generation and quantitative real-time PCR

SE-FRET microscopy

Statistics and reproducibility

3D cell morphology assays

TIRF microscopy

Western blot

Reporting summary

Data availability

References

Acknowledgements

Funding

Author information

Authors and Affiliations

Contributions

Corresponding authors

Ethics declarations

Competing interests

Peer review

Peer review information

Additional information

Extended data

Supplementary information

Source data

Rights and permissions

About this article

Cite this article

Share this article

Search

Quick links