Introduction

One of the world’s top producers of mung beans is India1. Globally, mungbeans are cultivated on around 7.3 million hectares, with an average yield of 721 kg/ha2. Between India and Myanmar, 5.3 million tonnes of output were generated, accounting for 30% of the total output worldwide3. However, mung bean cultivation is frequently challenged by environmental stressors, particularly soil salinity, which significantly reduces yield and soil fertility. Environmental conditions such as salinity, drought, and extreme temperatures negatively impact plant development and growth by inducing physiological, morphological, biochemical, and molecular alterations4,5,6. The impact of these abiotic stresses is intensifying in the face of global climate change. The world’s temperature has been increasing since 1970 which seriously affects agriculture7,8. As a result, agricultural production has declined by nearly 30%9. Among these stressors, salinity stress is one of the most significant threats to global crop production. Approximately 3% of the world’s entire geographical area is afflicted by salinity10,11. In the whole world, 33% of irrigated lands and 20% of cultivated lands are affected by salt12,13. This is particularly evident in arid and semi-arid regions, where soil degradation due to salinization occurs at a rate of 1–2% annually14, Additionally, secondary salinization often results from inappropriate agricultural practices such as excessive irrigation and poor drainage. Consequently, many productive lands are becoming unsuitable for farming, contributing to food insecurity in developing countries like India, where rising population demands intensify the need for sustainable crop production.

To meet increasing food demands, chemical fertilizers and pesticides are widely used, but their excessive application leads to negative environmental and health impacts. They degrade soil quality, harm beneficial microbes, and leave toxic residues. Therefore, the use of biofertilizers has emerged as an effective and eco-friendly alternative to support plant growth under stress conditions15,16. As microbes are considered a source of natural active compounds in agriculture, microbial consortia, especially those adapted to extreme environments, offer a promising solution for sustainable farming17,18. Thus, the development of consortia of plant growth-promoting rhizobacteria (PGPR) with the capacity to tolerate salinity, alkalinity, and temperature stress is essential to enhance plant growth in degraded and stress-prone soils.

Plant growth-promoting rhizobacteria (PGPR) are naturally occurring, free-living bacteria that interact with plant roots and promote growth through various mechanisms, such as phytohormone production, nutrient mobilization, and biocontrol of pathogens19,20. These PGPR are particularly important in stress environments where traditional biofertilizers may fail. The rhizosphere, a biologically active zone influenced by root exudates, harbors diverse microbial communities that play key roles in nutrient cycling and plant–microbe interactions21,22,23. These microbes can produce growth-promoting substances like indole-3-acetic acid (IAA), solubilize phosphate, and secrete siderophores and antifungal compounds, all of which contribute to plant growth under stress24.

Among these PGPR, Actinobacteria are gaining attention due to their metabolic versatility and stress resilience. Actinobacteria are Gram-positive, aerobic, filamentous bacteria with high G + C content, capable of producing a wide range of secondary metabolites and enzymes25,26. They are known for their ecological roles in nutrient cycling and soil structure maintenance18,27,28. Though many species grow at neutral pH and ambient temperature, some are extremophiles capable of tolerating high salt, alkaline pH, and elevated temperatures. These strains can produce hydrolytic enzymes with industrial and agricultural significance29,30. Haloalkaliphilic Actinobacteria, particularly from saline regions like coastal Gujarat, have demonstrated remarkable enzyme stability under extreme conditions30. For example, protease-producing strains such as Nocardiopsis alba OM-5 and Nocardiopsis xinjiangensis OM-6 have been reported to retain enzymatic activity at high temperatures and salt concentrations31,32. Despite growing evidence of their enzymatic potential, the plant growth-promoting attributes of such extremophilic Actinobacteria remain underexplored. Since salinity impacts both plant growth and the physicochemical and biological balance of soil, employing salt-tolerant and alkaliphilic microbes can provide a dual benefit, maintain soil health while boosting crop productivity10,33,34. In this study, four halo-alkali-thermo-tolerant PGPR strains belonging to phylum Actinobacteria and Firmicutes were isolated from the rhizospheric soil of the plant Euphorbia caducifolia L. collected from Kharaghoda, Little Rann of Kutch, Gujarat (India). These strains were examined for the PGP activities such as the production of IAA, ammonia, siderophores, and phosphatase. The selection was made to focus on strains with multifunctional traits and high tolerance to abiotic stresses, making them suitable candidates for bioformulation. Furthermore, a liquid bioformulation containing these stress-tolerant organisms was developed and evaluated for its ability to enhance plant growth under salinity and alkalinity conditions, offering a sustainable alternative to conventional agrochemicals.

Results

Isolation of bacterial strains

The rhizospheric salt-tolerant alkaliphilic strains KhEc44, KhEc 50, KhEc 68 and KhEc 69 were isolated from the desert Kutch. Strain KhEc 44 was obtained on the ISP 3 medium at 1:100 dilution, strain KhEc 50 was obtained on the ISP 4 medium at 1:100 dilution, strain KhEc 68 was obtained on the ISP 2 medium at 1:1000 dilution, and strain KhEc 69 was obtained on the ISP 4 medium at 1:1000 dilution. The colony of actinobacteria strain KhEc 44 on ISP 3 medium was medium-sized, filamentous, opaque, and grey sporulating. Strains KhEc 50, KhEc 68, and KhEc 69 appeared on ISP 4, ISP 2, and ISP 4 media respectively, as small to moderate, round, gummy, and creamy yellow or brownish colonies.

Identification of the strains

The 16S rRNA genes of Gram-positive isolates KhEc 44, KhEc50, KhEc 68 and KhEc 69 were amplified using universal primers and sequenced. These sporulating strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 were identified as Streptomyces sp., Bacillus haynesii, Bacillus paralicheniformis, and Priestia filamentosa, respectively. The sequences of these strains were compared using the BLAST algorithm. The GenBank accession numbers of Streptomyces sp. strain KhEc 44, Bacillus haynesii strain KhEc 50, Bacillus paralicheniformis strain KhEc 68, and Priestia filamentosa strain KhEc 69 are OM085673, OP279743, OM085674, and OM085675 respectively. The evolutionary relationships among the bacterial strains are depicted in Fig. 1(A). Each branch of the phylogenetic tree represents the evolutionary connections between the organisms. Different bacterial phyla, including Proteobacteria, Actinobacteria, and Bacillota, are indicated by distinct color ranges. Proteobacteria were used as the outgroup, representing a more distantly related lineage used for rooting the tree. The cluster analysis revealed that Streptomyces sp. strain KhEc 44 formed a distinct clade. While other studied isolates Priestia filamentosa strain KhEc 69, Bacillus haynesii strain KhEc 50, and Bacillus paralicheniformis strain KhEc 68 formed entirely separate clade, indicating significant evolutionary divergence among the strains Fig. 1.

Fig.1
figure 1figure 1

(A) 16S rRNA gene phylogenetic analysis of plant growth-promoting rhizobacteria isolated from the rhizosphere of Euphorbia caducifolia L. Phylogenetic tree was constructed using the maximum likelihood method, with bootstrap values indicated as black circles along the branches. Color-coded annotations were used to represent various phyla, including Proteobacteria, Actinobacteria, and Bacillota. Sequences from Proteobacteria served as outgroups. Sequences generated in this study are highlighted in maroon. The scale bar denotes 0.1 substitutions per site. (B) Heat map plots of physiological characterization including salinity (0–3 M NaCl), pH (7–10), and temperature (30–60℃) of strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69. Growth intensity was assessed qualitatively and categorized as + (low), + + (medium), + + + (high), or + + + + (very high).

Full size image

Detection of in vitro PGP activities

The strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 were screened for in vitro plant growth-promoting characteristics. Ammonia production was observed in all four isolates. Moreover, isolates KhEc 44, KhEc 50, KhEc 68, and KhEc 69 displayed 47.83, 60.22, 48.66, and 37.1 mg/L ammonia production respectively (Table 1). IAA (Indole acetic acid) production in tryptophan broth was indicated by pink color in three isolates. The maximum IAA production was observed in strain KhEc 69 (20.15 µg/mL) followed by KhEc 50 (3.79 µg/mL) and KhEc 68 (3.36 µg/mL) (Table 1). Siderophore production was observed as a yellow zone around the colony on the CAS agar plate in all isolates. The highest zone ratio 3.5 was observed in strain KhEc44 followed by 1.46, 1.43, and 1.25 zone ratios observed in strain KhEc 68, KhEc 50 and KhEc 69 respectively. The production of clear halo zones on Pikovaskya’s agar medium after eight days of incubation indicated phosphate solubilization. Among four isolates, three isolates showed a phosphate solubilization test positive. The largest diameter of the clear zone was observed in strain KhEc 44. Overall, two isolates KhEc 50 and KhEc 68 demonstrated the most promising PGP potential due to the production of ammonia, IAA, and siderophore. Besides, these two isolates displayed phosphate solubilization positive. Overall, multiple positive in vitro activities of isolated strains confirmed their plant growth-promoting potential (Table 1).

TABLE 1 Plant growth promoting attributes of bacteria isolated from the rhizospheric soil of plant Euphorbia caducifolia L.
Full size table

Effect of salt, pH and temperature on the growth of strains

The tolerance of four strains, KhEc 44, KhEc 50, KhEc 68, and KhEc 69, toward different abiotic stresses was analyzed. The optimum growth of all four strains was observed at 0 M NaCl concentration. However, strain KhEc 68 tolerated up to 2 M NaCl concentration, while strains KhEc 50, KhEc 68, and KhEc 69 tolerated up to 1 M NaCl concentration. All strains grew optimally at pH 8, while strains KhEc 50, KhEc 68, and KhEc 69 tolerated even pH 9 and pH 10, which indicated their alkali-tolerant nature. The strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 were considered mesophilic due to optimum growth at 30℃ however, strains KhEc 50 and KhEc 68 tolerated up to 50℃ temperature whereas, the strain KhEc 69 tolerated even up to 60℃ temperature indicating thermotolerant nature Fig. 1 (B).

Effect of salt on amylase secretion

The salt profile of amylase-producing alkaliphilic stains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 was determined by flooding the starch agar plate with Gram’s iodine. The starch agar plates were prepared with 0–20% NaCl (w/v). The presence of amylase was indicated by the clear zone due to starch hydrolysis surrounding the colony (Table 2). The strains KhEc 44 and KhEc 50 could grow and produce amylase up to 13% and 17% NaCl (w/v) respectively. The strains KhEc 68 and KhEc 69 tolerated up to 17% and 20% NaCl (w/v) respectively and produced amylase up to 13% and 15% NaCl (w/v) respectively. The highest amylase secretion was observed in strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 at 9%, 11%, 5% and 11% NaCl (w/v) respectively.

TABLE 2 Salt profile of bacteria isolated from the rhizospheric soil of plant Euphorbia caducifolia L.
Full size table

In vivo plant growth promoting activity

The effect of selected potent salt-tolerant alkaliphilic isolates KhEc 44, KhEc 50, KhEc 68, and KhEc 69 on seed germination of Vigna radiata (L.) R. Wilczek was studied (Fig. 2A).

Fig. 2
figure 2

(A) Seed germination of Vigna radiata (green gram) treated with strain KhEc 44 on the water agar plates. The results were observed after 1, 4, 7, and 10 days of incubation. (B) Seed germination of Vigna radiata (green gram) in the presence of strains KhEc 44, KhEc 50, KhEc 68 and KhEc 69. Values are mean ± standard deviation (n = 30). A two-way ANOVA was performed to determine effect of bacterial treatment on plant growth parameters and as * significant at the level P < 0.0332; ** significant at the level P < 0.0021; *** significant at the level P < 0.0002, **** significant at the level P < 0.0001 respectively. (C) PCA plot of seed germination of Vigna radiata (green gram) treated with control (a), strain KhEc 44 (b), strain KhEc 50 (c), strain KhEc 68 (d) and strain KhEc 69 (e).

Full size image

The rate of seed germination was higher in seeds treated with bacterial cultures when compared to control without treatment. All studied isolates displayed 98% seed germination. Plant root & shoot length, number of roots, and fresh weight of roots were enhanced due to the treatment of seeds with bacterial strains KhEc 68 and KhEc 69 followed by the treatment of actinobacteria strain KhEc 44. The seeds of Vigna radiata treated with the strain KhEc 44 showed higher shoot length (8.58 ± 0.83 cm) whereas a higher number of roots (18.77 ± 2.60) and high root length (6.43 ± 0.72 cm) was recorded when seeds were treated with the strain KhEc 69 (Fig. 2B). Principal component analysis (PCA) revealed that strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69, with shoot lengths ranging from 5.10 to 8.60 cm and root lengths from 2.70 to 6.40 cm, clustered together. The PCA plot provides a visual representation of the relationships among these strains and their associated growth traits especially shoot and root length, highlighting their potential plant growth-promoting (PGP) activity in vivo (Fig. 2C). In the pot experiments, the seeds treated with strain KhEc 44 showed higher shoot length (30.02 ± 0.10 cm) and higher fresh weight of shoot (2.09 ± 0.10 g) whereas higher root length (27.57 ± 0.73 cm) and higher fresh weight of root (2.12 ± 0.15 g) was detected when seeds were treated with the strain KhEc 68 (Figs. 3 and 4). After the pot experiment, the PCA plot was analysed of strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 with shoot lengths in the range of 25.30 to 28.00 cm, and root lengths in the range of 22.20 to 27.60 cm. The PCA showed that the strains KhEc 68 and KhEc 69 were closely related while strain KhEc 44 and strain KhEc 50 dwell in entirely separate spots on the PCA plot. (Figs. 3 and 4).

Fig. 3
figure 3

(A) Pot experiments of Vigna radiata (green gram) treated with control (a), strain KhEc 44 (b), strain KhEc 50 (c), strain KhEc 68 (d) and strain KhEc 69 (e). Values are mean ± standard deviation (n = 30). A two-way ANOVA was performed to determine the effect of bacterial treatment on plant growth parameters and as * significant at the level P < 0.0332; ** significant at the level P < 0.0021; *** significant at the level P < 0.0002, **** significant at the level P < 0.0001 respectively. (B) PCA plot of pot experiments of Vigna radiata (green gram) treated with control (a), strain KhEc 44 (b), strain KhEc 50 (c), strain KhEc 68 (d) and strain KhEc 69 (e).

Full size image
Fig. 4
figure 4

The fresh and dry weight of shoot, root and leaves of Vigna radiate (green gram) inoculated with strains KhEc 44, KhEc 50, KhEc 68 and KhEc 69. Values are mean ± standard deviation (n = 30). A two-way ANOVA was performed to determine the effect of bacterial treatment on fresh weight and dry weight of shoot and root and as * significant at the level P < 0.0332; ** significant at the level P < 0.0021; *** significant at the level P < 0.0002, **** significant at the level P < 0.0001 respectively.

Full size image

The consequence of salt stress on plants Vigna radiata was observed in the presence of bacterial strains. The seeds treated with strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 were inoculated in the agar plates containing NaCl, whereas, in the pot experiments, the water supplied in pots contained 0 to 120 mM NaCl. The growth parameters of uninoculated seeds of Vigna radiata were decreased with increased salt stress, while the growth parameters of treated seeds were enhanced in a high-salt environment (Fig. 5). In the control plant, the shoot length of 12.40 ± 0.80 cm and root length of 12.50 ± 0.50 cm were recorded while in comparison, the seeds treated with strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 enhanced shoot lengths of 13.79 ± 0.32 cm, 14.79 ± 0.89 cm, 13.33 ± 0.14 cm, and 13.92 ± 0.90 cm respectively, and root length 14.62 ± 0.57 cm, 16.58 ± 0.62 cm, 11.62 ± 1.50 cm, and 15.00 ± 0.33 cm respectively at 20 mM NaCl (w/v) (Fig. 5B). In salt stress conditions, the seeds treated with stains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 displayed growth even at 120 mM (Fig. 5). Consequently, these isolates can increase relative water content (RWC) and promote the survival rate of plants in saline conditions, which helps in osmotic adjustment, ion exclusion, turgor pressure maintenance, and cell membrane integrity preservation of host plants.

Fig. 5
figure 5figure 5

(A) The effect of salt stress at 0 mM (a), 20 mM (b), 40 mM (c), 80 mM (d) and 120 mM (e) on seed germination of Vigna radiata (green gram) in presence of strains KhEc 44 KhEc 50, KhEc 68 and KhEc 69. Values are mean ± standard deviation (n = 30). A two-way ANOVA was performed to determine effect of bacterial treatment on plant growth parameters and as * significant at the level P < 0.0332; ** significant at the level P < 0.0021; *** significant at the level P < 0.0002, **** significant at the level P < 0.0001 respectively. (B) Effect of salt stress at 0 mM (a), 20 mM (b), 40 mM (c), 80 mM (d) and 120 mM (e) on the growth of plant Vigna radiata (green gram) in presence of strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69. Values are mean ± standard deviation (n = 30). A two-way ANOVA was performed to determine the effect of bacterial treatment on plant growth parameters and as * significant at the level P < 0.0332; ** significant at the level P < 0.0021; *** significant at the level P < 0.0002, **** significant at the level P < 0.0001 respectively.

Full size image

The consortium of actinobacteria with other microbes can further enhance plant growth and improve soil health. Therefore, the seeds of the plant Vigna radiata were treated with a mixture of four isolates KhEc 44 (B), KhEc 50 (C), KhEc 68 (D), and KhEc 69 (E) in various combinations. The combinations prepared were strains KhEc44 + KhEc 50 (F), strains KhEc 44 + KhEc 68 (G), strains KhEc 44 + KhEc 69 (H), strains KhEc 50 + KhEc 68 (I), strains KhEc 50 + KhEc 69 (J), strains KhEc 68 + KhEc 69 (K), strains KhEc 44 + KhEc 50 + KhEc 68 (L), strains KhEc 44 + KhEc 50 + KhEc 69 (M), strains KhEc 50 + KhEc 68 + KhEc 69 (N), strains KhEc 44 + KhEc 68 + KhEc 69 (O) and strains KhEc 44 + KhEc 50 + KhEc 68 + KhEc 69 (P). ​The co-inoculation of microbes showed better results compared to the inoculums with a single microorganism. The shoot & root length, and the number of roots, were increased when seeds were treated with a consortium of bacteria (Figs. 6 & 7). The maximum growth of mung bean was observed with the combination of strains KhEc 44 + KhEc 68 + KhEc 69 with shoot length (18.58 ± 0.5 cm) and root length (15.33 ± 3.40 cm) which was twofold higher compared to the control with shoot length (8.45 ± 0.15 cm) and root length (7.00 ± 0.60 cm) (Fig. 7). Overall, the consortium of bacteria strains substantially improved growth parameters (Figs. 6, 7). The PCA plot was constructed to evaluate the effects of bacterial consortia on the seed germination and plant growth parameters, including shoot length and root length. In seed germination experiments, the PCA plot showed a distinct position of consortium ‘O’ compared to consortia ‘A’ to ‘N’, and ‘P’ that were nearby and formed a single cluster (Fig. 6). However, in the pot experiments, the consortia H, O, C, F, and G were observed at discrete positions from the cluster of consortia A, B, D, E, I, J, K, L, M, N, and P (Fig. 7). A significant difference was observed in a PCA plot of seed germination and pot experiments performed in vivo. These analyses indicated that consortium treatments significantly improved the shoot & root length of Vigna radiata after 10 days of the seedling. Therefore, the soil containing plant growth-promoting rhizobacteria enhanced growth parameters significantly in pot experiments compared with germination experiments.

Fig. 6
figure 6

(A) The seed germination of Vigna radiata (green gram) treated with a consortium of strains KhEc 44, KhEc 50, KhEc 68 and KhEc 69. The grouping of KhEc 44 + KhEc 50 (F), KhEc 44 + KhEc 68 (G), KhEc 44 + KhEc 69 (H), KhEc 50 + KhEc 68 (I), KhEc 50 + KhEc 69 (J), KhEc 68 + KhEc 69 (K), KhEc 44 + KhEc 50 + KhEc 68 (L), KhEc 44 + KhEc 50 + KhEc 69 (M), KhEc 50 + KhEc 68 + KhEc 69 (N), KhEc 44 + KhEc 68 + KhEc 69 (O) and KhEc 44 + KhEc 50 + KhEc 68 + KhEc 69 (P) and PCA plot of consortia (A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, and P). (B) seed germination of Vigna radiata (green gram) in presence of consortium of strains KhEc 44, KhEc 50, KhEc 68 and KhEc 69. Values are mean ± standard deviation (n = 30). A two-way ANOVA was performed to determine effect of bacterial treatment on plant growth parameters and as * significant at the level P < 0.0332; ** significant at the level P < 0.0021; *** significant at the level P < 0.0002, **** significant at the level P < 0.0001 respectively.

Full size image
Fig. 7
figure 7

(A) The pot experiments of Vigna radiata (green gram) treated with a consortium of strains KhEc 44, KhEc 50, KhEc 68 and KhEc 69. The grouping of KhEc 44 + KhEc 50 (F), KhEc 44 + KhEc 68 (G), KhEc 44 + KhEc 69 (H), KhEc 50 + KhEc 68 (I), KhEc 50 + KhEc 69 (J), KhEc 68 + KhEc 69 (K), KhEc 44 + KhEc 50 + KhEc 68 (L), KhEc 44 + KhEc 50 + KhEc 69 (M), KhEc 50 + KhEc 68 + KhEc 69 (N), KhEc 44 + KhEc 68 + KhEc 69 (O) and KhEc 44 + KhEc 50 + KhEc 68 + KhEc 69 (P) and PCA plot of these consortia (A, B, C, D, E, F, G, H, I, J, K, L, M, N, O, and P). (B) pot experiments of Vigna radiata (green gram) in the presence of a consortium of strains KhEc 44, KhEc 50, KhEc 68 and KhEc 69 Values are mean ± standard deviation (n = 30). A two-way ANOVA was performed to determine the effect of bacterial treatment on plant growth parameters and as * significant at the level P < 0.0332; ** significant at the level P < 0.0021; *** significant at the level P < 0.0002, **** significant at the level P < 0.0001 respectively.

Full size image

In vivo experiments with Vigna radiata revealed discernible differences between consortium ‘O’ and other consortia (A, B, C, D, E, F, G, H, I, J, K, L, M, N, and P). Nevertheless, a significant increase in mung bean plant was observed in the presence of consortium ‘O’ (Fig. 7). The liquid formulation of consortium ‘O’ prepared using salt-tolerant, alkali-tolerant, and thermo-tolerant plant growth-promoting rhizobacterial strains KhEc 44, KhEc 68, and KhEc 69 enhanced the shoot & root length, as well as number of roots of mung beans. The T4 treatment increased plant growth parameters such as shoot length (22.0 cm ± 1.0) and root length (19.6 ± 1.15 cm) compared to the control shoot length (8.6 ± 0.76 cm) and root length (7.0 ± 1.0 cm) (Fig. 8). The combination of seed treatment and application of liquid formulation significantly improved growth parameters of mung beans. The Streptomyces sp. strain KhEc 44 enhanced siderophore production, Bacillus paralicheniformis strain KhEc 68 displayed good phosphate solubilization ability and Priestia filamentosa strain KhEc 69 increased IAA production. Overall, the isolated strains KhEc 44, KhEc 68, and KhEc 69 were compatible with each other and provided favorable conditions to enhance mung bean growth.

Fig. 8
figure 8

The pot experiments of Vigna radiata (green gram) treated with a consortium of strains KhEc 44, KhEc 68 and KhEc 69. The treatment of control (T1), seed treatment (T2), liquid formulation (T3), and seed treatment + liquid formulation (T4).

Full size image

Discussion

In the present study, rhizospheric salt-tolerant, alkali-tolerant, and thermo-tolerant strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 isolated from Euphorbia caducifolia L. were screened for plant growth-promoting traits. The strains KhEc 50, KhEc 68, and KhEc 69 were the most promising in preliminary screening. Based on 16S rRNA gene sequencing, the strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 were identified as Streptomyces sp. (98.13%), Bacillus haynesii (97.5%), Bacillus paralicheniformis (97.3%), and Priestia filamentosa (97.8%) respectively. Actinobacteria, such as Streptomyces sp. KhEc 44, exhibited typical filamentous sporulating organism that grew optimally on ISP 3 medium. Similarly, Olanrewaju and Babalola (2019) explained that the colony morphology of Streptomyces was spore-forming and filamentous with multiple nuclei35. Non-actinobacterial strains showed cream to orange-cream colonies, supporting genus-level identification and colony diversity consistent with Bacillus sp.36.

All four strains showed considerable abiotic stress tolerance, a critical trait for rhizobacteria from saline-alkaline habitats. Strains KhEc 50, KhEc 68, and KhEc 69 tolerated 1 M NaCl, with KhEc 68 tolerating up to 2 M NaCl, indicating robust halotolerance. Recently, Ji et al., 2020) examined the bacterial strain Glutamicibacter sp. (YD01) that tolerated 10% NaCl (w/v) and showed positive PGP traits such as ACC deaminase and IAA production37. More recently, the bacterial strain Metabacillus dongyingensis sp. nov. BY2G20 displayed genetic traits for tolerance toward saline-alkaline conditions and plant growth promotion. It grew at pH ranges between 7—9 and improved Zea mays L. (maize) growth when exposed to salt stress38. Similarly, Verma et al. (2018) observed the growth of plant growth-promoting Bacillus strains in the range of 30℃ to 60℃ and a combination of strains also enhanced the growth of the Vigna radiata plant39.

All four isolates exhibited key PGP traits (Table 1), ammonia production was exhibited by most isolates, a crucial nitrogen source for plant nutrition40. A mutualistic symbiotic relationship exists between the mung bean and the Rhizobium leguminosarum. Rhizobium receives food and shelter from the mung bean in exchange of fixing nitrogen for the plant41. The microbes produce various plant growth regulators that are associated with the stimulation of plant growth19, including IAA production (1.25–20.15 µg/mL), with KhEc 69 producing the highest IAA (20.15 µg/mL). Similarly, Lasudee et al. (2018) studied Streptomyces that could produce IAA (0.74–11.12 µg/mL) in the presence of L-tryptophan42. Recently, Chauhan et al. (2020) observed IAA-producing rhizospheric bacterial strain Asp49 from Salvadora persica L. collected from the desert Kutch43. The production of siderophore plays a substantial role in the antagonism of phytopathogen and consequently improves plant growth44. Siderophore production, particularly by KhEc 44, formed clear yellow halo zone on the CAS medium, indicating efficient iron chelation. This supports pathogen suppression and improved Fe acquisition, consistent with studies on Streptomyces sp.45,46. Phosphate solubilization was observed in KhEc 44, KhEc 50, and KhEc 68, suggesting organic acid production mechanisms. Earlier, Lasudee et al. (2018) reported that Streptomyces strain 48, S1, and S3 produced a clear zone on Pikovskaya’s agar by solubilizing tricalcium phosphate42. Moreover, Bacillus firmus XSB375, a phosphate-solubilizing rhizobacteria with plant growth-promoting properties, w isolated from the canola rhizosphere. This strain improved seed germination, early emergence, plant vigor, root and shoot growth, and crop yield47. Overall, isolated rhizobacteria with multiple plant growth-promoting traits would emerge as a suitable approach for crop health management.

The rhizospheric bacteria are potential producers of various extracellular enzymes that can directly or indirectly promote plant growth. It has an active role in the hydrolysis of the starch during seed germination. Microorganisms that can produce a mucolytic enzyme are considered biocontrol agents for plant diseases48. All strains demonstrated salt-tolerant amylase production, indicating biocatalytic activity under stress (Table 2). Amylase production in the presence of salt was reported in halophilic organisms such as Bacillus dipsosauri, and Acinetobacter sp. Halobacillus sp., Halobacterium halobium, Haloferax mediterranei, Micrococcus halobios, Natronococcus amylolyticus, Marinobacter sp., and Haloarcula sp.49,50,51.

The bacterial strains promoted the growth of rice52, mung bean53, wheat54, and tomato55. The beneficial effect of microbes present in the soil on roots was stated earlier by Uphoff et al. (2009)56. The in vivo pot study validated the PGP potential of all strains. Significant increases in shoot and root length, fresh and dry biomass, and number of leaves and roots were observed in treated plants compared to controls (Figs. 2 & 3). The plant growth-promoting capabilities of Streptomyces strains were previously documented by Dutta & Thakur (2020), encompassing the synthesis of indole-3-acetic acid (IAA), siderophores, ammonia, and the solubilization of phosphate57. Similarly, Gopalakrishnan et al. (2015) reported application of Streptomyces strains (CAI-17, CAI-68, CAI-78, KAI-26, and KAI-27) resulted in enhancements of growth parameters, including plant height, shoot weight, leaf weight, and stem weight in chickpea plant58. More recently, Chauhan and Gohel (2022) examined the bacterial strain Georgenia soli TSm39 that boosted the growth of Vigna radiata L.59.

Salinity affects most germination and vegetative growth of plants. In the present study, the growth of plant Vigna radiata L. ​was observed under salt (NaCl w/v) stress conditions when the seeds were treated with strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 (Fig. 5). It was reported that the presence of salt-tolerant actinobacteria especially Streptomyces sp. induced salinity tolerance up to 1 M NaCl which controls the effect of salt and allows the growth of the wheat plant60. Similarly, Wang et al. (2018) described that the inoculum of Bacillus sp. improves the growth of Capsicum annuum L. under saline conditions61.

The growth of Vigna radiata enhanced when treated with the consortium of strains KhEc 44 (phylum: Actinobacteria), KhEc 68 (phylum: Firmicutes) and KhEc 69 (phylum: Firmicutes) (Fig. 7). Previous studies have demonstrated that Bacillus sp. enhanced plant growth by synthesizing a range of plant growth hormones, including indole acetic acid (IAA), gibberellin, and cytokinin62. Certain Bacillus species have been shown to synthesize several growth hormones, valuable for the physiology of plants63. The biofertilizers of plant growth-promoting rhizobacteria enhanced the plant growth and yield. The effect of PGPR on sesame growth was more distinct when the PGPRs were utilized as a consortium as compared to the results obtained when PGPRs were utilized individually64. Sreevidya et al. (2016) showed that Streptomyces sp. survived in high alkaline conditions and improved the growth of Cicer arietinum L.65. Similarly, Palaniyandi et al. (2014) observed salt-tolerant Streptomyces sp. PGPA3 which survived at 06% NaCl (w/v)66. Silambarasan et al. (2019) reported that the consortium of bacterial strains significantly enhanced the growth of Vigna radiata L.67. even under drought stress. Likewise, Kumar et al. (2017) also found that consortium rhizobacteria including Enterobacter sp., Serratia marcescens, and Microbacterium arborescent significantly improved nutrient uptake and yield of the wheat plant as compared to single strain inoculation68. Actinobacteria combined with other microorganisms improved plant growth significantly and was also important in the biochemical processes of the soil69. Furthermore, Jorge et al. (2020) introduced a liquid biofertilizer containing Azospirillum brasilense CECT 5802 and Pantoea dispersa CECT 5801 strains70.

Overall, this study identified multiple abiotic stress-tolerant bacterial isolates from Euphorbia caducifolia L. rhizosphere that exhibit diverse PGP attributes. Strain KhEc 44 (Streptomyces sp.) was a potent siderophore producer and moderately effective in phosphate solubilization. Strains KhEc 50 and KhEc 68 (Bacillus sp.) showed tolerance to salinity and alkalinity, alongside strong ammonia production. Strain KhEc 69 (Priestia filamentosa) was the most effective in terms of IAA production and root promotion in mung bean. The observed in vitro PGP traits were consistent with the improvements recorded in germination and plant biomass under greenhouse conditions. The formulation of a liquid biofertilizer incorporating halo, alkali, and thermo-tolerant PGPR strains Streptomyces sp. KhEc 44, Bacillus paralicheniformis KhEc 68, and Priestia filamentosa KhEc 69 belonging to the phyla Actinobacteria and Firmicutes have demonstrated effectiveness in improving stress tolerance and promoting the growth of mung bean crops. This study highlights the potential of indigenous microbial resources for sustainable agriculture and provides valuable insights for the development of biofertilizers that can improve mung bean crop productivity, especially in challenging environments. Further investigation is essential to elucidate the specific mechanisms underlying the observed plant–microbe interactions.

Materials and methods

Bacterial strains

The salt-tolerant alkaliphilic bacterial strains KhEc 44, KhEc 50, KhEc 68, and KhEc 69 were isolated from the rhizospheric soil of the plant Euphorbia caducifolia L. collected from Kharaghoda, Little Rann of Kutch, Gujarat (India) [Latitude: 23;1;13.2400 and Longitude: 71;42;50.7499]. This sandy saline soil contained high nitrogen (155.52 kg/ha), iron (6.36 mg/kg), manganese (41.65 mg/kg), and zinc (6.46 mg/kg). The soil was alkaline with 8.57 pH. Moreover, other soil properties included a moisture content of 4.36%, water holding capacity of 50.4%, EC 1.23 dS/m, organic carbon content of 1.35 kg/ha, phosphorus content of 1.52 kg/ha, sulphur 3.91 mg/kg, calcium 3680 mg/kg, and magnesium 1440 mg/kg. The isolation was carried out by the standard dilution plate method. The sterile distilled water of 10 mL was mixed with 1 g soil sample and heat-treated at 60℃ for 20 min in the water bath. The serial dilution of up to 10–3 of the heat-treated sample was spread on different agar media such as ISP 1 (tryptone yeast extract broth), ISP 2 (yeast malt agar), ISP 3 (oatmeal agar), ISP 4 (inorganic salt starch agar), ISP 5 (glycerol asparagine agar), ISP 6 (peptone yeast extract iron agar), ISP 7 (tyrosine agar), AIA (actinomycete isolation agar), SA (starch agar), SCA (starch casein agar) and NA (nutrient agar) as described by Gohel et al. (2018)71. Plates were incubated at 28 °C for 8–10 days. Isolated colonies with distinctive morphological features were streaked on an agar medium. The pure culture plates were stored at 4℃.

Identification of the strains

The amplification of the 16S rRNA gene was accomplished with forward primer 27 F (5’ AGAGTTTGATCCTGGCTCAG 3’) and reverse primer 1492R (5’ TACGGTTACCTTGTTACGACTT 3’) to obtain 1500 bp product. Initial denaturation was performed at 94○C for 5 min, then 35 cycles of denaturation at 94○C for 20 s, annealing at 58○C for 20 s and extension at 72○C for 1 min 30 s. The final extension was performed at 72○C for 10 min. The negative control contained all the components of the PCR reaction except for the DNA template. The PCR products were confirmed on 0.8% agarose gel containing ethidium bromide (5 µl/mL) to ensure the fragments were of the correct size. The gel was visualized on a UV transilluminator (Bangalore Genei, India). The amplified 16S rRNA gene product was sequenced using the big dye terminator sequencing method (Sanger Sequencing). The sequences were submitted to the NCBI database. The sequences were aligned using the MUSCLE algorithm in MEGA X. The tree was exported in Newick format and visualized using iTOL (https://itol.embl.de/). A phylogenetic tree was constructed using the Maximum Likelihood method, and its reliability was assessed with a bootstrap analysis of 1000 replicates. All identification experiments were done in duplicate to ensure reproducibility.

In vitro plant growth promoting traits

Ammonia production

For ammonia production, spore cultures of isolates were inoculated into 10 mL of peptone water (Himedia, India). Subsequently, the tubes were incubated at 28 °C ± 2℃ for 7–8 days at 150 rpm. Following the incubation period, the tubes were centrifuged at 3000 rpm for 10 min. Then, the supernatant was transferred into another tube and 1 mL of Nessler’s reagent was added to the supernatant. The development of brown color indicated a positive test and the absorbance was determined at 425 nm. The ammonium sulfate standard curve (10.0 to 100 mg/L) was used to measure the ammonia content17. Experiments were conducted in triplicate and included uninoculated control.

Indole acetic acid (IAA) production

A loopful of spores was inoculated into 1 mg/mL tryptophan-containing broth and incubated for 8–10 days at 28○C and 150 rpm. After the incubation period, the broth was subjected to centrifugation at 5000 rpm for 10 min, and 4 mL of Salkowski’s reagent (1 mL 0.5 M Ferric chloride; 50 mL 35% solution of perchloric acid) was added to 2 mL of the supernatant. The development of pink color after incubation of 10 min in the dark condition indicated a positive test for IAA production. The absorbance was measured at 530 nm by a UV–visible spectrophotometer (Specord 200+, Analytikjena, Germany). Experiments were conducted in triplicate and included uninoculated control.

Siderophore production

Bacterial strains were spot-inoculated in a medium containing chrome azurol S (CAS) agar to determine siderophore production72. The plates were incubated at 28 °C for 8–10 days. The yellow halo zone around the colonies was regarded as siderophore production positive. Experiments were conducted in triplicate and included uninoculated control.

Phosphate solubilization

The detection of phosphate solubilization was performed using Pikovskaya’s agar medium. The isolates were spot inoculated on Pikovaskya’s agar embedded with bromophenol blue dye and incubated for 8–10 days at 28○C. The isolates that exhibited a distinct zone surrounding the colony were categorized as positive for phosphate solubilization73. The phosphate solubilization activity of bacteria was measured by calculating the phosphate solubilization index (PSI). Experiments were conducted in triplicate and included uninoculated control.

PSI = [Diameter of clear zone (colony + halo zone) mm/Diameter of the colony (mm)].

Physiological characterization

Effect of salinity

The Luria Bertani (LB) broth containing 0 M, 1 M, 2 M, and 3 M NaCl was used to examine the effect of salt on the growth of organisms. The absorbance of the culture was measured at 660 nm using a UV–visible spectrophotometer (Specord 200, Analytik Jena, Germany). Experiments were conducted in triplicate and included uninoculated controls.

Effect of pH

The LB broth with pH 7 to 11 was used to examine the optimum pH for growth because the rhizobacteria were isolated from the alkaline soil sample. Following incubation, the absorbance of the culture was measured at 660 nm after 24 and 48 h using a UV–visible spectrophotometer (Specord 200, Analytik Jena, Germany). Experiments were conducted in triplicate and included uninoculated controls.

Effect of temperature

The effect of temperature was observed by inoculating selected isolates in the LB broth. The temperatures such as 30, 40, 50 and 60℃ were used to grow the organisms. After the incubation, the absorbance of the culture was measured at 660 nm after 24 and 48 h using a UV–visible spectrophotometer (Specord 200, Analytik Jena, Germany). Experiments were conducted in triplicate and included uninoculated controls.

Secretion of amylase in the presence of salt stress

The germination stage of the plant growth is generally affected by the amylase secretion. Therefore, the detection of amylase secretion was performed on a starch agar medium49. Moreover, the salt profile was examined by adding 0%, 3%, 5%, 7%, 9%, 11%, 13%, 15%, 17, % and 20% NaCl (w/v) into the starch agar plate. The isolates KhEc 44, KhEc 50, KhEc 68 and KhEc 69 were spot inoculated on starch agar medium and incubated for 7–8 days at 28ºC. Detection of amylase production was carried out by flooding the plates with Iodine. The iodine reacts with the starch agar medium and it becomes deep blue in color. The presence of a clear zone around the colony signified the secretion of amylase. The diameter of the colony and the zone of starch hydrolysis were measured, and the relative enzyme activity (REA) was determined using the formula stated below. Experiments were done in triplicate.

REA = Diameter of zone of clearance in cm/Diameter of colony in cm.

In vivo experiments

The potential strains such as KhEc 44, KhEc 50, KhEc 68, and KhEc 69 were selected for in vivo experiments based on their superior performance in multiple plant growth-promoting traits and abiotic stress tolerance abilities. The seeds of the plant Vigna radiata (dicotyledon plant) were surface sterilized. For that, the seeds of Vigna radiata were soaked in absolute alcohol for 1 min and into 5% sodium hypochlorite then 5 times washed using sterile distilled water for 1 min. The treated seeds were soaked for 2 h in cell culture (Absorbance 1 at 660 nm) of selected isolates. Control seeds were immersed in sterile distilled water for 2 h. After drying, the treated seeds were buried in the water agar (10 seeds per plate, 3 replicates) and the plates were incubated at 28℃ for 10 days. Following incubation, shoot length, root length, the number of leaves, and the number of roots were measured. Also, the % seed germination was calculated.

The experiment was done in pots containing 1 kg sterile soil (autoclaved twice for 20 min). The treated seeds were sown into the pots (10 seeds per pot in 3 replicates, n = 30) and kept in the dark condition. After germination, pots were put in the natural environment and sterile distilled water was supplied once a day. Seed germination and pot experiments were performed with 3 biological replicates (n = 30 per treatment) and included appropriate negative control (untreated seeds).

Salt stress and seed germination

The seeds of Vigna radiata were treated with isolates KhEc 44, KhEc 50, KhEc 68, and KhEc 69 to examine the effect of salt stress on seed germination. These treated seeds were sown into the agar plates containing a range of 0 to 120 mM salt. The pots were filled with sterile soil for the pot experiments. The treated seeds were sown in the pots (10 seeds/pot in 3 replicates, n = 30). The pots were kept in dark condition. After the seed germination, the pots were transferred to the natural environment. The water containing a range of 0 to 120 mM salt was supplied to different pots once during sowing to provide salt stress.

Effect of the consortium on seed germination and plant growth

The seeds of Vigna radiata were treated with a consortium of four isolates including KhEc 44, KhEc 50, KhEc 68, and KhEc 69. Various combinations of these isolates were used such as KhEc 44 + KhEc 50, KhEc 44 + KhEc 68, KhEc 44 + KhEc 69, KhEc 50 + KhEc 68, KhEc 50 + KhEc 69, KhEc 68 + KhEc 69, KhEc 44 + KhEc 50 + KhEc 68, KhEc 44 + KhEc 50 + KhEc 69, KhEc 50 + KhEc 68 + KhEc 69, KhEc 44 + KhEc 68 + KhEc 69, and KhEc 44 + KhEc 50 + KhEc 68 + KhEc 69. After 30 days, growth parameters including shoot & root length, number of leaves & roots, as well as fresh & dry weight of shoot, root and leaves were measured (triplicate pots, n = 30 seeds/treatment).

Liquid formulation strategies

The liquid formulation was prepared by inoculating strains KhEc 44, KhEc 68, and KhEc 69 individually in the LB medium. Subsequently, the activated cultures (1 absorbance at 600 nm) were diluted in LB broth aseptically to gain 1–5 × 108 CFU/mL. Then, sterilized protective substances such as 1% lactose, and 2% glycerol were added to the consortium, mixed properly, and stored at 4℃ temperature to avoid direct sunlight. This liquid formulation was applied to the pot by establishing different treatments such as control in which no treatment was applied to mung beans (T1), mung beans were socked in bacterial formulation before sowing (T2), direct application of the formulation to the soil after germination (T3), mung beans were soaked in the formulation and the formulation was again applied to the soil after germination (T4). The plant growth parameters were noted after 30 days of incubation. Experiments were performed in triplicate and stability was monitored at intervals.

Statistical analysis

The data in triplicates of in vitro and in vivo experiments were used to obtain the mean and standard deviation (mean ± SE, n = 30). The graphs were produced by using GraphPad Prism 9.3.1. The statistical analysis was conducted by analysis of variance (ANOVA) with IBM SPSS Statistics version 22. The mean values were compared through the Duncan multiple range test using significance differences at P < 0.05. Moreover, the PCA plot was constructed using Past 4.03 software to compare the impact of various consortia on the growth of test plants in vivo.