Allergen-induced NLRP3/caspase1/IL-18 signaling initiate eosinophilic esophagitis and respective inhibitors protect disease pathogenesis

Yadavalli, Chandra Sekhar; Upparahalli Venkateshaiah, Sathisha; Kumar, Sandeep; Kandikattu, Hemanth Kumar; Oruganti, Lokanatha; Kathera, Chandra Sekhar; Mishra, Anil

doi:10.1038/s42003-023-05130-4

Download PDF

Article
Open access
Published: 31 July 2023

Allergen-induced NLRP3/caspase1/IL-18 signaling initiate eosinophilic esophagitis and respective inhibitors protect disease pathogenesis

Chandra Sekhar Yadavalli¹,
Sathisha Upparahalli Venkateshaiah¹,
Sandeep Kumar^1,2,
Hemanth Kumar Kandikattu¹,
Lokanatha Oruganti^1,3,
Chandra Sekhar Kathera¹ &
…
Anil Mishra ORCID: orcid.org/0000-0003-4266-4684¹

Communications Biology volume 6, Article number: 763 (2023) Cite this article

8411 Accesses
13 Citations
233 Altmetric
Metrics details

Subjects

Abstract

The current report describes a stepwise mechanistic pathway of NLRP3/caspase1/IL-18-regulated immune responses operational in eosinophilic esophagitis (EoE). We show that esophageal epithelial cells and macrophage-derived NLRP3 regulated IL-18 initiate the disease and induced IL-5 facilitates eosinophil growth and survival. We also found that A. fumigatus-exposed IL-18^−/− mice or IL-18-neutralized mice are protected from EoE induction. Most importantly, we present that intravascular rIL-18 delivery to ΔdblGATA mice and CD2-IL-5 mice show the development of EoE characteristics feature like degranulated and intraepithelial eosinophils, basal cell hyperplasia, remodeling and fibrosis. Similarly, we show an induced NLRP3-caspase1-regulated IL-18 pathway is also operational in human EoE. Lastly, we present the evidence that inhibitors of NLRP3 and caspase-1 (MCC950, BHB, and VX-765) protect A. fumigatus- and corn-extract-induced EoE pathogenesis. In conclusion, the current study provides a new understanding by implicating NLRP3/caspase1-regulated IL-18 pathway in EoE pathogenesis. The study has the clinical significance and novel therapeutic strategy, which depletes only IL-18-responsive pathogenic eosinophils, not naïve IL-5-generated eosinophils critical for maintaining innate immunity.

An esophagus cell atlas reveals dynamic rewiring during active eosinophilic esophagitis and remission

Article Open access 18 April 2024

Esophageal ILC2s mediate abnormal epithelial remodeling in eosinophilic esophagitis via Areg-EGFR signaling

Article Open access 09 December 2024

Bidirectional crosstalk between eosinophils and esophageal epithelial cells regulates inflammatory and remodeling processes

Article 10 May 2021

Introduction

Esophageal eosinophilia is commonly observed in diverse gastrointestinal problems including eosinophilic esophagitis (EoE)^1,2, a disease with increasing incidence across the globe^3,4. The characteristic endoscopic features observed in EoE patients include furrows, rings (corrugated esophagus) and extensive tissue remodeling^5,6,7. EoE and gastroesophageal reflux diseases (GERD) are closely related esophageal disorders that were previously differentiated by proton-pump inhibitor (PPI) responsiveness (>15 esophageal eosinophilia/hpf reported guidelines)⁸; however, the latest guidelines of the Appraisal of Guidelines for Research and Evaluation (AGREE) II omits this criterion⁹. Evidence suggests that inflammatory responses caused by environmental or food allergens are key to the development of EoE^10,11,12. In recent years, genetic factors have also been associated with promoting EoE pathogenesis^13,14. The induction of allergen-induced cytokines like IL-5, IL-13, IL-18, and IL-33 are implicated in the pathogenesis of EoE^2,15,16,17; however, clinical trials testing several cytokine neutralizers including anti-IL-5, anti-IL-13, and anti-IL-4R have not yet provided satisfactory results in improving EoE.

IL-18 is an IFN-γ-inducing factor and a member of the IL-1 family of cytokines, which has a wide range of inflammatory and allergy disease-related functions¹⁵. In previous work, we established that IL-18 can generate an IL-5-independent subset of CD274^-expressed pathogenic eosinophils and transform IL-5-generated naïve eosinophils into CD274⁺pathogenic eosinophils^17,18. IL-18 is produced by antigen-presenting cells and epithelial cells via activation of the inflammasome NLRP3 (NOD-like receptor protein-3)/caspse-1 pathway¹⁹. NLRP3 activation is also implicated in inflammatory responses in allergic diseases including asthma and several gastrointestinal disorders²⁰. We recently found evidence for the role of IL-18 in promoting eosinophilic asthma pathogenesis¹⁸ and observed induced IL-18 in blood and IL-18R mRNA in biopsies of EoE patients¹⁵. Several inhibitors of the NLRP3 inflammasome have been reported to prevent tissue destruction in NLRP3-related allergic diseases in experimental models²¹, and our current data provide evidence that NLRP3 and caspase-1 are potential therapeutic targets for EoE. NLRP3 inhibitors like N-[[(1,2,3,5,6,7-hexahydro-s-indacen-4-yl)amino]carbonyl]-4-(1-hydroxy-1-methylethyl)-2-furansulfonamide (MCC950), β-hydroxybutyrate (BHB), and the caspase1 inhibitor Belnacasan (VX-765) are the most selective and well-characterized inhibitors currently available and have been evaluated in a wide variety of NLRP3-activated inflammatory disorders. In a mouse model, MCC950 and BHB have shown important therapeutic promise for treating inflammation and fibrosis^22,23. Accordingly, we focused our current studies on understanding the stepwise mechanism underlying the induction of NLRP3-caspase1-regulated IL-18-mediated EoE pathogenesis. In this study, we show that mice challenged with aeroallergen (Aspergillus) or food allergen (corn) develop NLRP3 and caspase-1 induction and activation in accumulated esophageal macrophages and epithelial cells. These cells are the source of NLRP3 and caspase1-regulated IL-18, that induce esophageal eosinophilic inflammation and pathogenesis of EoE. We also observed a similar induction of NLRP3/caspase1-regulated IL-18 induces eosinophilic inflammation in mice and a similar mechanistic pathway is operational in human EoE. We present evidence that treatment with NLRP3 and caspase1 inhibitors and IL-18 neutralization protects against allergen-induced EoE pathogenesis in a murine model of EoE, which provides evidence for an alternative treatment strategy to Th₂ cytokine neutralization immunotherapy for EoE^2,16,24. Of note, anti-IL-5 therapy (mepolizumab or Dupixent) reduces blood eosinophils but does not satisfactorily improve or prevent EoE^25,26. Most recently, the FDA has approved Dupixent (anti-IL-4Rα) 300 mg weekly as treatment for human EoE in a limited Phase 3 randomized, double-blind, placebo-controlled trial. Initial data show 300 mg Dupixent weekly is marginally effective and safe for patients 12 years and older but showed only a 69 and 64% reduction in EoE symptoms from baseline compared to 32 and 41% for placebo. The end point is only 30% improvement by Dupixent compared to placebo²⁷ and remains unclear what other symptoms improved in EoE patients by Dupixent treatment. IL-5 serves as a growth and survival factor for eosinophils and regulate IL-13 that binds with IL-4Rα. The presented data indicates that allergen-induced NLRP3/caspase1-regulated IL-18 pathway initiate the disease, not the Th₂ cytokines IL-5 or IL-13 or eotaxin-3. Further, these findings have a support of earlier reports that CD4-, CD8-, STAT6-, IL-13-, eotaxin-, and IL-13/IL-4 double gene-deficient mice are not protected from allergen-induced EoE²⁸. These reports indicate that epithelial cells derived IL-18 is sufficient to generate, transform and accumulate pathogenic eosinophils to esophageal epithelial mucosa. Therefore based on these novel findings, we propose several approaches to improve human EoE pathogenesis by proposing to conduct a clinical trial of IL-18 neutralization, and also inhibiting NLRP3, caspase1 using respective antagonist. Most importantly, the proposed trial will deplete only IL-18 generated or transformed CD274⁺ pathogenic eosinophils.

Results

Esophageal epithelial cells and some macrophages are the source of NLRP3-regulated IL-18 in aeroallergen (Aspergillus fumigatus)-induced EoE

Induced IL-18 has been reported in human EoE¹⁵; however, the mechanisms underlying IL-18 induced EoE pathogenesis are not yet understood. IL-18 is regulated by the inflammasome NLRP3/caspase-1 pathway, we first examined the expression of NLRP3 in esophageal tissue sections of an aeroallergen (Aspergillus fumigatus)-induced murine model of experimental EoE. Mice were challenged with A. fumigatus (100 µg) as per the established protocol² and schematically shown (Fig. S1a; created with BioRender.com). We performed anti-NLRP3 and anti-F4/80 immunofluorescence staining on esophageal tissue sections to identify the source of NLRP3-regulated IL-18 in EoE and found induced expression of anti-NLRP3 (green) in epithelial cells and anti-NLRP3⁺anti-F4/80 (red) in macrophages in the A. fumigatus-challenged mice (Fig. 1a, i–ii). We then performed anti-NLRP3 (green) and anti-IL-18 (red) double immunofluorescence staining, which detected colocalization of anti-NLRP3 and anti-IL-18 (yellow) expression in epithelial cells and accumulated lamina propria macrophages in the esophageal tissue sections of A. fumigatus-challenged mice (Fig. 1b, i–ii). Morphometric quantification analysis showed significantly higher NLRP3 and F4/80 positive cells (Fig. 1a, iii) and IL-18 positive cells (Fig. 1b, iii) in A. fumigatus-challenged mice compared to saline-challenged mice. These data indicate that both macrophages and epithelial cells are sources of NLRP3-regulated IL-18 in EoE. Further, we performed anti-MBP tissue immunostaining to detect esophageal eosinophilia, including intraepithelial eosinophils (Fig. 1c, i–ii). Morphometric quantification analysis showed significantly induced NLRP3-regulated IL-18-mediated esophageal eosinophils in A. fumigatus-challenged mice (Fig. 1c, iii). The anti-Ki-67 immunostaining of esophageal tissue sections indicated higher epithelial cell proliferation and quantification in A. fumigatus-challenged mice compared to saline-challenged mice (Fig. 1d, i–iii). We validated the induction of total and activated NLRP3, caspase1, IL-18, and the eosinophilic granule protein EPX in the esophagus by performing western blot analysis in saline and A. fumigatus-challenged mice (Fig. 1e). NLRP3 is detected as different isoform by Western blot and 120 kda protein band is the actual size and other bands is its isoforms. Additionally, to establish that tissue immunostaining detected NLRP3, and IL-18 in epithelial cells and macrophages are not an artifact. Therefore, we also isolated inflamed esophageal epithelial cells and macrophages from the A. fumigatus challenged mice and performed Western blot analysis to examine NLRP3, Caspase1 and IL-18. The western blot and densitometry analysis showed that epithelial cells were indeed the source of induced NLRP3, IL-18, IL-1β and eosinophilic granular proteins, compared to macrophages that showed mostly comparable NLRP3 and caspase1 in A. fumigatus challenged mice compare to saline challenged isolated cells (Fig. 1f, g). The two different isoforms of NLRP3 are detected in between 110–120kda. The full-length variant and a variant lacking exon 5. Some antibodies detect both forms of isoforms and some do not. The functional characteristics of both isoforms are not well understood. The correct full-length NLRP3 is detected on 120 kda. Further, the activated (pNLRP3) is the essential priming event that triggers an immune response via the activation of caspase 1 to induce inflammatory cytokines like IL-1β and IL-18. Without the detection of phosphorylated NLRP3 (pNLRP3), it is difficult to conclude that NLRP3 regulated immune regulation is operating to induce inflammation process. Thus, the pNLRP3 is an essential priming event for inflammasome activation that triggers an immune response via caspase 1 to induce IL-18 (Fig. 1f). A similar high transcript expression of F4/80, IL-18, and eosinophil-responsive IL-5 and IL-13 in A. fumigatus-induced experimental EoE (Fig. 1h). The induced IL-5 and IL-13 transcript indicates their role in EoE, but possibly in eosinophils growth, survival, and progression of disease pathogenesis. Further, we also present detailed immunofluorescence representative photomicrographs of individual anti-NLRP3, anti-F4/80, and anti-IL-18 expression for saline-challenged mice (Fig. S1b, c, i–iv) and A. fumigatus-challenged mice (Fig. S1d, e, i–iv). Accumulation of collagen and profibrotic cytokine anti-TGF-β⁺ cells in the esophageal tissue sections of A. fumigatus-challenged mice compared to saline-challenged with quantitative significant increase (Fig. S1f, g, i–iii).

**Fig. 1: Allergen-induced NLRP3 induces IL-18-mediated pathogenesis of eosinophilic esophagitis (EoE).**

Analysis of NLRP3-regulated IL-18 expression in corn-allergen-induced EoE

Further, we also examined that NLRP3-regulated IL-18 signaling pathway is also operational in promoting food allergen-induced EoE pathogenesis. Accordingly, we sensitized mice with 1 mg alum and 200 µg corn extract intraperitoneally then challenged them three times intranasally with corn extract (100 µg) as per the established protocol²⁹ (Fig. S2a; created with BioRender.com). We chose the intranasal route since we have found that the route is most effective in promoting EoE in mice, then the inoculation via esophagus. We earlier showed that esophagus and trachea are connected through local lymph nodes that accumulate eosinophils and route to esophagus²⁹. Both A. fumigatus-challenged and corn extract-sensitized/corn-challenged mice showed induced NLRP3 and IL-18 in F4/80⁺ macrophages and epithelial cells following respective antibody immunostaining of esophageal tissue sections compared to corn extract-sensitized/saline-challenged mice (Fig. 2a, b, i–ii). Morphometric quantification analysis showed significantly higher NLRP3⁺ F4/80⁺ and NLRP3⁺ IL-18⁺ cell counts in esophageal tissue sections of corn-sensitized/corn-challenged mice compared to corn-sensitized/saline-challenged mice (Fig. 2a, b, iii). The Anti-MBP immunostaining revealed esophageal eosinophilia in corn-sensitized/corn-challenged mice, including infiltration of eosinophils in the epithelial layer (Fig. 2c, i–ii) and the quantification detected significantly induced number of anti-MBP⁺ cells (Fig. 2c, iii). Similarly, we also observed induced anti-Ki-67 expressed proliferative epithelial cells that showed significantly induced Ki-67⁺ cells in the tissue sections of corn-sensitized/saline-challenged mice (Fig. 2d, i–iii) in corn alum-sensitized/corn-challenged mice compared to corn alum-sensitized/saline-challenged mice. We also performed Western blot and densitometry analysis on the isolated epithelial cells and accumulated macrophage from inflamed esophagus of corn-sensitized/corn-challenged mice to confirm the induction of NLRP3, Caspase1, IL-18, IL-1β and eosinophilic granular protein EPX. The analysis showed that epithelial cells indeed the source of induced NLRP3- mature IL-18 and eosinophilic granular proteins, compare to macrophages that showed mostly comparable NLRP3 and caspase1 in corn sensitized and corn challenged mice (Fig. 2e, f). Detailed immunofluorescence analysis of anti-NlRP3, anti-F4/80 anti-NLRP3, and anti-IL-18 of esophageal tissue sections of corn-sensitized/corn-challenged mice and corn-sensitized/saline-challenged mice are shown (Fig. S2b–e). Further to show that IL-18 directly induces EoE pathogenesis, we also performed Western blot analysis on rIL-18 exposed isolated esophageal epithelial cell and macrophages from naïve mice. The analysis indicated that rIL-18 treated both cell types inducing inflammatory cytokines without inducing NLRP3 and caspase1 (Fig. S2f).

**Fig. 2: Corn extract-induced EoE pathogenesis.**

IL-18 overexpression promotes EoE pathogenesis

Since both accumulated macrophages and epithelial cells induce NLRP3 regulated IL-18; we first tested the hypothesis that overexpression of in vivo IL-18 stimulates eosinophil precursors to develop eosinophils and provide EoE in mice. We injected five doses of 10 µg rIL-18 plus 100 µl saline or only 100 µl saline intravenously into wild-type and GATA1-deficient (ΔdblGATA) mice on alternate days for 10 days. We chose the intravenous route because ΔdblGATA mice are deficient in tissue eosinophils but have bone marrow eosinophil precursors¹⁸. The rIL-18-treated mice developed esophageal eosinophilia compared to no or few eosinophils in saline-treated mice (Fig. 3a, i). The rIL-18-treated ΔdblGATA mice showed several characteristics of EoE including intraepithelial eosinophils (Fig. 3a, ii), Ki-67⁺ epithelial cell proliferation (Fig. 3b, i–ii), and accumulation of collagen in esophageal tissue sections (Fig. 3c, i–ii). Morphometric quantification of MBP⁺, Ki-67⁺, and collagen showed significant induced in rIL-18-treated ΔdblGATA mice compared to saline-treated ΔdblGATA mice (Fig. 3a–c, iii). In addition, we also performed Western blot analysis of esophageal extract of saline and rIL-18 given CD2-IL5 and ΔdblGATA mice, which showed baseline expression of NLRP3 in CD2-IL-5 mice but not in GATA1 mice and no expression of Caspase1 in both these mice. This may be due to the presence of eosinophils in saline challenged CD2-IL-5 mice, indicating that NLRP3 pathway is operational. However, following rIL-18 treatment to GATA1 mice showed induced IL-18 and eosinophils granular protein EPX and profibrotic cytokine TGF-β that confirms rIL-18 has a direct response in promoting EoE pathogenesis in GATA1 mice (Fig. 3e).

**Fig. 3: IL-18 promotes EoE characteristics in *ΔdblGATA* and *CD2-IL-5* transgenic mice.**

Earlier, we also previously reported in vitro that IL-18 transform naïve eosinophils to pathogenic eosinophils¹⁷. Therefore, to establish that rIL-18 indeed transform in vivo IL-5 generated naïve eosinophils to pathogenic eosinophils; therefore, we used CD2-IL-5 mice that do not have intraepithelial eosinophilia and degranulated eosinophils. Both intraepithelial eosinophils and degranulated eosinophils, which is the characteristic of EoE¹⁶. Thus, we treated CD2-IL-5 mice with 10 µg rIL-18 plus 100 µl saline or 100 µl saline alone intravenously five times on alternate days for 10 days and examined eosinophils accumulation in the esophagus of mice. The anti-MBP immunostaining of esophageal tissue sections showed many intraepithelial eosinophilia and extracellular eosinophilic granules following degranulation in rIL-18-injected CD2-IL-5 mice compared to saline-challenged CD2-IL-5 mice that showed mostly lamina propria eosinophils (Fig. 3d, i–ii). These data confirms our previous in vitro observation¹⁷ regarding in vivo IL-5-generated naïve eosinophils transformation to pathogenic eosinophils. Morphometric quantification of MBP⁺ cells showed a significant increase in esophageal eosinophils in rIL-18-treated CD2-IL-5 mice compared to saline-challenged CD2-IL-5 mice (Fig. 3d, iii). Further, a comparable number of eosinophils is detected in the esophageal sections of rIL-18 given CD2-IL-5 mice and rIL-18 given ΔdblGATA mice by anti-EPX immunostaining analysis, but the Western blot analysis indicated a highly induced esophageal EPX in IL-18 given CD2-IL-5 mice compare to ΔdblGATA mice (Fig. 3e).

Critical role of IL-18 in A. fumigatus-induced experimental EoE

Next, to establish a critical role of IL-18 in EoE pathogenesis, we examined wild-type and IL-18^−/− mice following the induction of A. fumigatus-induced experimental EoE. Esophageal tissue sections were immunostained with anti-MBP antibodies. We observed a high number of MBP⁺ eosinophils accumulation in the esophageal tissue sections of A. fumigatus-challenged wild-type mice but only few detected in IL-18^−/− mice, and in saline-challenged mice (Fig. 4a, b, i–ii). Morphometric quantification of MBP⁺ eosinophils revealed a significantly reduced accumulation of anti-MBP⁺ eosinophils in A. fumigatus-challenged IL-18^−/− mice compared to A. fumigatus-challenged wild-type mice (Fig. 4c). We also examined anti-Ki-67⁺ proliferating epithelial cells following immunostaining for anti-Ki-67 (Fig. 4d, e, i–ii) that indicated number of Ki-67⁺ cells are significantly decreased in the esophageal tissue sections of A. fumigatus-challenged mice compare to Aspergillus-challenged IL-18^−/− mice, both saline-challenged IL-18^−/− mice and wild-type mice show comparable baseline eosinophils (Fig. 4f). Further, a similar observation was observed for profibrotic anti-TGF-β immunostaining and the quantitation of TGF-β⁺ cells indicated significantly decreased number in the esophageal tissue sections of A. fumigatus-challenged IL-18^−/− mice compared to wild-type mice (Fig. 4g, h, i–ii; 4i). A similar reduced collagen accumulation following Masson’s trichrome staining analysis in the A. fumigatus-challenged IL-18^−/− mice compared to wild-type mice challenged with A. fumigatus (Fig. 4j, k, i–ii). Deposited collagen tissue thickness as measured by morphometric quantitative analysis indicated a significantly reduced collagen accumulation in the esophagus of A. fumigatus-challenged IL-18^−/− mice compared to wild-type mice (Fig. 4l). Furthermore, we also analyzed transcript levels of the Th₁ cytokine IL-18, macrophage receptor F4/80, inflammasome NLRP3 and the transcript levels of Th₂ cytokine IL-4, IL-5, IL-13. The transcripts levels of all the examined molecules were found to significantly decrease in A. fumigatus-challenged IL-18^−/− mice compared to wild-type mice (Fig. S3).

**Fig. 4: *IL-18* deficiency reduces esophageal eosinophilia and tissue remodeling in *A. fumigatus*-induced experimental EoE.**

Furthermore, because we observed that IL-18^−/− mice are protected from A. fumigatus-induced experimental EoE, we further wanted to rule out the possibility that allergen-induced EoE protection found in whole-body IL-18^−/− is not an artifact. We performed anti-IL-18 neutralization treatment on the A. fumigatus-challenged wild-type mice and found a significantly reduced eosinophil accumulation (Fig. 4m), Ki-67⁺ epithelial cell proliferation (Fig. 4m), TGF-β⁺ cells (Fig. 4m), and collagen accumulation (Fig. 4n) in anti-IL-18 neutralized mice compared to isotype-matched IgG-treated mice. The anti-MBP, anti-Ki-67, anti-TGF-β and collagen accumulation representative photomicrographs are shown (Fig. S4).

Examine the role of mature macrophages in A. fumigatus-induced NLRP3-regulated IL-18-mediated experimental EoE pathogenesis

Several reports indicate that mature macrophages are the main source of the NLRP3 activation that induces IL-18, so we tested the hypothesis that mature macrophage deficiency prevents NLRP3 activation-associated IL-18-mediated EoE pathogenesis. Thus, we first examined the expression of NLRP3 and IL-18 following anti-F4/80 and anti-NLRP3 double immunofluorescence analysis in saline- and A. fumigatus-challenged wild-type and GM-CSF^−/− mice. The analysis detected A. fumigatus-challenged wild-type mice have NLRP3 expression in both accumulated F4/80⁺ macrophages and epithelial cells of A. fumigatus-challenged wild type (Fig. 5a i–ii) compared to NLRP3 expression mostly in the epithelial cells of A. fumigatus-challenged GM-CSF^−/− mice (Fig. 5b, i–ii). Morphometric analysis confirmed a significantly decreased number of NLRP3/⁺F4/80⁺cells (Fig. 5c). Similarly, we also analyzed NLRP3 and IL-18 expression in A. fumigatus-challenged wild-type mice and GM-CSF^−/− mice using anti-NLRP3 and anti-IL-18 immunofluorescence analysis on the esophageal tissue sections. The analysis detected both accumulated NLRP3⁺IL-18⁺ cells in the accumulated macrophages and epithelial cells of A. fumigatus-challenged wild-type mice (Fig. 5d, i–ii) compared to NLRP3⁺IL-18⁺ mostly in the epithelial cells of A. fumigatus-challenged GM-CSF^−/− mice (Fig. 5e, i–ii). Morphometric analysis showed significantly reduced NLRP3⁺ IL-18⁺ cells (Fig. 5f). The Anti-MBP, anti-Ki-67 immunostaining detected higher MBP⁺ eosinophils, and Ki-67⁺ epithelial cells in wild-type A. fumigatus-challenged mice (Fig. 5g, j, i–ii) compared to GM-CSF^−/− of A. fumigatus-challenged mice (Fig. 5h, k, i–ii). Morphometric quantitation showed both MBP⁺ and KI-67⁺ cells significantly reduced in A. fumigatus-challenged GM-CSF^−/− mice compared to A. fumigatus-challenged wild-type mice (Fig. 5i, l). Further, we also examined that in GM-CSF^−/− mice indeed the epithelial cells are the source of NLRP3 and IL-18; thus, to confirm we first immunostained the esophageal tissue sections by anti-cytokeratin, anti-NLRP3 and anti-IL-18. The analysis showed all A. fumigatus-challenged mice showed anti-cytokeratin⁺ epithelial cells expression with induced expression of NLRP3 in DAPI mounted tissue sections (Fig. 5m, i–iv), and similarly IL-18 expression in anti-cytokeratin⁺ epithelial cells in DAPI mounted tissue sections (Fig. 5n, i–iv). Further, we presented detailed individual immunofluorescence analysis of anti-NLRP3 and anti-F4/80 (Fig. S5a–d, i–iv) and anti-NLRP3 and anti-IL-18 in the esophageal tissue sections of saline- and A. fumigatus-challenged mice (Fig. S5e–h, i–iv). These analyses indicated that mature macrophage deficiency is not sufficient to protect mice from the induction of experimental EoE, as esophageal epithelial cells also express induced NLRP3-regulated IL-18 in allergen-induced EoE.

**Fig. 5: Wild-type and *GM-CSF* gene-deficient mice detected eosinophilic inflammation-mediated epithelial cells proliferation in *A. fumigatus*-challenged experimental EoE.**

Induced expression of NLRP3, caspase1, and IL-18 expression is observed in CD163⁺ macrophages and epithelial cells in active human EoE

Next, we set out to investigate whether a similar NLRP3, caspase1 regulated induced IL-18 mediated mechanism operational in human EoE. Thus, we examined NLRP3, caspase1, and IL-18 expression in the biopsies of healthy individuals and active EoE patients by performing anti-cytokeratin, anti-NLRP3, anti-caspase1 and anti-CD163 immunofluorescence analysis. The analysis detected anti-cytokeratin immunofluorescence stain epithelial cells show very few anti-cytokeratin⁺NLRP3⁺ cells, anti-NLRP3⁺CD163⁺ macrophages, anti-NLRP3⁺caspase1⁺ cells, and anti-NLRP3⁺IL-18⁺ in normal patient biopsies (Fig. 6a–d, i) compared to induced expression of anti-cytokeratin⁺NLRP3⁺ cells, anti-NLRP3⁺CD163⁺ macrophages, anti-NLRP3⁺caspase1⁺ cells, and anti-NLRP3⁺IL-18⁺ in the biopsies of active human EoE (Fig. 6a–d, ii). Morphometric analyses indicated significantly higher levels of anti-CD163⁺, anti-NLRP3⁺, anti-caspase1⁺, and anti-IL-18⁺ cells in EoE patients compared to non-EoE individuals (Fig. 6a–d, iii). Detailed individual immunofluorescence of anti-CD163⁺, anti-NLRP3⁺, anti-caspase1⁺, anti-cytokeratin⁺ and anti-IL-18⁺ are shown in Fig. S6. To confirm that the biopsies analyzed were indeed from active EoE patients, we performed anti-EPX immunostaining analysis and found high counts of esophageal intact eosinophils (yellow arrow) and extracellular eosinophilic granules (blue arrows) in active EoE patient biopsies compare to no detectable eosinophils in normal individual in the tissue sections (Fig. 6e, i–ii). Morphometric analysis detected statistically significant (~100-fold) anti-EPX eosinophils in EoE patient biopsies compared to controls (Fig. 6e, iii). ELISA analysis detected high levels of IL-18, which correlated with tissue eosinophilia (Fig. 6f). Real-time PCR analysis revealed increased transcript levels of CD163, NLRP3, and caspase-1 from tissue RNA in active human EoE compared to normal biopsies (Fig. 6g).

**Fig. 6: Induced NLRP3, caspase1, IL-18 and eosinophilic inflammation detected in human eosinophilic esophagitis (EoE).**

Pharmacologically delivered NLRP3 (MCC950, BHB) or caspase-1 (VX-765) inhibitors prevent EoE pathogenesis in mice challenged with Aspergillus fumigatus or corn extract

Since, innate immune system, macrophages and epithelial cells are equipped with the NLRP3 inflammasome that regulates IL-18²³. IL-18 is reported to generate and transform IL-5-generated naïve eosinophils into pathogenic eosinophils¹⁸. Thus, to determine whether NLRP3 inhibitors can be used as a novel therapeutic option to prevent allergen-induced EoE pathogenesis. Accordingly, we examined the effects of two intraperitoneally injected NLRP3 inhibitors, β-hydroxybutyrate (BHB) and MCC950, in our A. fumigatus-challenged murine model of experimental EoE. A schematic representation of inhibitors treatment protocol for aeroallergen (Aspergillus fumigatus) and corn sensitized-corn challenged induced murine model of experimental EoE shown (Fig. S7a, b; created with BioRender.com). Both inhibitors (MCC950 and BHB) treated mice had reduced anti-NLRP3-expression in epithelial cells and macrophages following A. fumigatus challenge (Fig. 7a, i–vi) compared to saline-given mice (Fig. 7a, iv). Morphometric analysis confirmed that after A. fumigatus challenge, mice with MMC950 or BHB had significantly reduced NLRP3 expression in epithelial and IL-18⁺ cells compared to those injected with saline (Fig. 7b). Similarly, we also observed the effect of the NLRP3 downstream caspase1 inhibitor Belnacasan (VX-765) on A. fumigatus-induced experimental EoE. We found markedly reduced anti-caspase1 and anti-IL-18 expression in F4/80⁺ macrophages and epithelial cells in A. fumigatus-challenged mice treated with VX-765 compared with A. fumigatus-challenged mice given saline (Fig. 7c, d, i–ii). Morphometric analysis showed significantly reduced caspase-1 expression in epithelial cells and IL-18⁺ macrophages (Fig. 7e). Further, reduced NLRP3 expression is associated with a significant reduction in eosinophil accumulation in the esophagus of A. fumigatus-challenged mice for MCC950, BHB and VX-765 compared to controls (Fig. 7f, i–viii). Morphometric quantification indicated a significant reduction in anti-MBP⁺ eosinophils in both NLRP3 inhibitor-treated (MCC950, BHB and VX-765) A. fumigatus-challenged mice compared to A. fumigatus-challenged mice treated with saline (Fig. 7g). A similar eosinophils reduction in corn and MCC950 treated esophageal tissue sections following anti-MBP treated mice was observed compared to Aspergillus alone treated mice (Fig. 7h). A statistically significant reduction in the number of eosinophils was observed (Fig. 7i). Additionally, we also analyzed cytokine IL-18 levels using ELISA that shows significant reduction in mice challenged with A. fumigatus and treated with MCC950 mice compared with A. fumigatus-challenged mice treated with saline (Fig. 7j). Furthermore, we performed Western blot analysis to validate immunofluorescence and immunostaining and found highly reduced NLRP3, pNLRP3, pro and mature-caspase1, active and inactive IL-18, eosinophilic granular protein EPX, and fibrosis-associated TGF-β in the esophagus of Aspergillus-challenged mice treated with MCC950 compared to those treated with saline (Fig. 7k). Though, our analysis observed some variation in the IL-18 levels of MCC950 group of mice between ELISA compared to Western blot analyses; but note, no significant difference observed between the two control of saline and MCC950 treated group of mice by ELISA analysis. The variation in ELISA analysis may be due to some technical or manual error during washing the plate due to the trapped tissue particles in the wells on ELISA plate of a particular group. Additionally, we also examined details individual immunostaining of anti-Ki-67 esophageal epithelial cell proliferation and profibrotic cytokine TGF-β⁺ cells in A. fumigatus-challenged mice treated with MCC950, BHB and VX-765 compared to saline-given mice and showed a statistically significant TGF-β⁺ and Ki-67⁺ cells in esophageal tissue sections as cells/mm² (Fig. S7b, d, f, h, i, i–iii; c, e, g, i). Furthermore, we also presented a detail of individual anti-NLRP3 and anti-IL-18⁺ immunofluorescence analysis of the following saline, A. fumigatus and A. fumigatus-challenged mice treated with MCC950 and BHB are shown (Fig. S8a–f, i–iv). Details of individual anti-NLRP3 and anti-F4/80⁺ immunofluorescence analysis of following saline, corn and corn-challenged mice treated with MCC950 (Fig. S8g–i, i–iv), and anti-NLRP3 and anti-IL-18⁺ immunofluorescence analysis of following saline, corn and corn-challenged mice treated with MCC950 (Fig. S8j–l, i–iv). In addition, the immunofluorescence details for anti-caspase1 and anti-IL-18 individual molecules treated with saline, A. fumigatus and A. fumigatus with VX-765 are also provided (Fig. S9a–d, i–iv).

**Fig. 7: NLRP3 inflammasome inhibitors protect against *Aspergillus*-induced EoE in a mouse experimental model.**

Discussion

Eosinophilic esophagitis (EoE) was first recognized as a distinct clinical and pathologic syndrome in the 1990s³⁰. It has since become a common cause of esophageal symptoms such as dysphagia, food bolus impaction, heartburn, vomiting, regurgitation, and odynophagia. Estimates of its global prevalence range from 0.5 to 1 case per 1000 people around the world³¹. EoE is becoming more common, with about 5–10 new cases per 100,000 people each year³², but no reliable therapies are available. Evidence indicates that inflammatory cells induced by aeroallergens, insect allergens, and food allergens have an important role in EoE pathogenesis^2,29,33. The FDA recently approved therapy with the IL-4Rα antibody dupilumab, which improves some symptoms of EoE, but detailed data has not yet been released. Its effects on EoE pathogenesis are not surprising, as dupilumab (anti-IL-4Rα) reduces M2 macrophage features, including a shift in cell surface marker protein expression and gene expression³⁴. IL-5-regulated IL-13 binds to IL-4Rα, which has an important role in eosinophil survival and progression of pathogenesis³⁵. This further supports our findings that macrophage/epithelial cell-induced responses have a role in the initiation and progression of EoE pathogenesis. Some factors previously implicated in the pathogenesis of EoE include allergen-induced cytokines (e.g., IL-5, IL-13, IL-33), epithelial cells, nerve cell-derived chemokines, induction of eotaxin-3 and VIP, and genetic factors^{15,17,36,37,38,39,40}; however, targeting these Th₂ cytokines has not yet been shown to successfully block EoE pathogenesis with any clinical significance. We recently reported that IL-18 also has a critical role in differentiation and maturation of CD274⁺CD101⁺-expressing pathogenic eosinophils¹⁸. Despite major advances in understanding of the development of some characteristic features of chronic EoE, the mechanistic factors responsible for the onset of EoE following allergen exposure are not yet clearly understood. In the current study, we presented evidence that IL-18 is required to promote EoE pathogenesis even in CD2-IL-5 mice as well in tissue eosinophils-deficient ΔdblGATA mice. The pharmacologically delivered rIL-18 to CD2-IL-5 mice transformed naïve eosinophils to pathogenic intraepithelial eosinophilia and degranulating extracellular eosinophilic granules. Though, immunostaining detected comparable esophageal eosinophilia in rIL-18 given CD2-IL-5 and ΔdblGATA mice. However. the Western blot analysis indicated induced eosinophilic granular protein in rIL-18 given CD2-IL-5 mice that indicates IL-5 generate naïve eosinophils in combination with IL-18 that generate and mature pathogenic eosinophils. These data is consistent with our earlier reported that IL-18 in vitro alone capable to generates and even transforms naïve IL-5-generated eosinophils into pathogenic eosinophils¹⁷ suggests that IL-18 is critical and may explain why EoE is not effectively treated with anti-IL-5 (mepolizumab) or anti-IL-13 therapy. IL-5 is not an initiator of EoE but a surviving factor for eosinophils⁴¹. Furthermore, it has been reported that chemokines eotaxin-3 has a role in human EoE pathogenesis; however, eotaxin-3 is not detected in mice. Though, esophageal mucosa accumulates eosinophils in ΔdblGATA and CD2-IL-5 mice following pharmacological delivery of rIL-18. Earlier reports also indicated that eotaxin is highly induced in naive esophagus, but devoid of eosinophils, indicating a limited role of eotaxin-3 in EoE pathogenesis⁴². Additionally the anti-IL-5 therapy also raises concerns regarding long-time treatment effects on eosinophil biology and their significance in the maintenance of innate immunity⁴³. It is important to understand the consequences of eosinophil depletion following anti-IL-5 therapy on human natural innate host defense. The eosinophils-deficient IL-5 gene-deficient mice and GATA1 gene-deficient mice, both develop tissue eosinophilia following disease induction in experimental models^18,43,44. The GM-CSF^−/− mice develop some autoimmune defects and even if we rescue GM-CSF^−/− via r-GM-CSF addition; we will not obtain any additional information related to needed information and is the limitation of current study. A recent report indicated that these mice have slow breeding rates, produce low numbers of pups, and lose reproduction capacity much earlier than the normal mice⁴³. It is well established that IL-4 is critical for higher functions of the normal brain, such as memory and learning⁴⁵; therefore, age-associated long term effect should be carefully examined for FDA-approved Dupixent (anti-IL4Rα) for EoE treatment. The inhibition of cytokines like IL-5 and IL-4 may compromise innate immunity of pediatric EoE patients, whose innate immune systems are still in developing stage⁴⁶.

High IL-18 levels have also been reported in allergen-induced experimental and human EoE^37,47. We have shown that both Aspergillus and corn extract challenge induce NLRP3 and caspase1 in esophageal epithelial cells and accumulated inflammatory macrophages in murine models of EoE these findings are consistent with the reports that indicates NLRP3 and caspase1 activation induces IL-18^48,49. We provide evidence for a similar NLRP3- and caspase1-regulated IL-18 mechanistic pathway following allergen-induced EoE in mice. Allergen-induced NLRP3- caspase pathway also induce IL-1β, but this cytokine is not involved in generation or maturation of eosinophils; thus, no study is performed on the role of IL-1β in the initiation and progression of EoE. This induced IL-18 promotes eosinophil accumulation and degranulation in tissues and contributes to the development of EoE pathogenesis, including remodeling and fibrosis. We also show the evidence that a similar NLRP-3-caspase-1-IL-18 mechanistic pathway is operational in human EoE. In addition, we also provided evidence that IL-18 delivery promotes EoE pathogenesis even in blood- and tissue-deficient ΔdblGATA mice which have no tissue eosinophils but has only bone marrow eosinophil precursors. Importantly, we present direct evidence that IL-18 neutralization or IL-18 deficiency in mice restricts the formation of most of the pathological characteristics observed in EoE, and that treatment with NLRP3 or caspase1 inhibitors protects mice from developing aeroallergen or food allergen-induced EoE.

We recognize that some limitations exist in experimental mouse models that include intranasal or intravascular inoculation of allergen- or cytokine; but the models are well established and closely mimic human EoE. The EoE characteristics include accumulation of esophageal macrophages, activation of NLRP3 and caspase1, and the presence of IL-18 and CD274⁺ eosinophil subsets, intraepithelial cells, epithelial cells proliferation, and fibrosis. Given the paucity of mechanistic information and treatment strategies for EoE, we feel the proposed studies are highly relevant and are poised to have a major impact on establishing the significance of NLRP3-IL-18 pathway in the initiation of EoE pathogenesis.

We presented sufficient evidence in establishing the critical role for IL-18 in the onset of EoE and show that pretreatment with NLRP3 and caspase1 inhibitors like MCC950, BHB, and VX-765 protects both food allergen- and aeroallergen-induced EoE pathogenesis in EoE experimental model. First, we show that epithelial cell- and macrophage-induced NLRP3-regulated IL-18 are mechanistically critical in promoting aeroallergen- and food allergen-indued EoE, which is in accordance with previously reported induced IL-18 in human EoE¹⁵. Second, we showed that IL-18 overexpression promotes EoE pathogenesis, including proliferation of intraepithelial eosinophil and epithelial cells, in tissue eosinophil-deficient ΔdblGATA mice and CD2-IL5 global eosinophilic mice. These data support previous findings that IL-18 differentiates and transforms IL-5-generated naïve eosinophils into pathogenic eosinophils¹⁷. Third, we present evidence that IL-18-deficiency and IL-18 neutralization both protect allergen-induced EoE, which supports previous findings that neutralization of iNKT cells has a critical role in allergen-induced EoE, as IL-18 activates iNKT cells to induce eosinophil growth and survival cytokines IL-5 and IL-13⁵⁰. Fourth, we show that NLRP3-caspase1 and IL-18 are induced in human EoE biopsies compared to normal individuals, indicating the similar mechanism operate in human EoE. Lastly, we show that targeting neutralized IL-18, NLRP3 and caspase1 inhibitors are a novel therapeutic strategy for human EoE.

The evidence presented in the current study is novel and clinically important for EoE patients, particularly children suffering from the disease. This approach deserves prompt attention and multicentral double-blind human clinical trials using NLRP3 and caspase-1 inhibitors. VX-765, an orally absorbed pro-drug of VRT-043198, is a potent and selective inhibitor of the ICE/caspase1 subfamily and is available for human use, making it an ideal candidate for human trials targeting EoE via NLRP3 downstream caspase1. Relevantly, the proposed clinical trials are important in view of targeting only IL-18 generated and matured pathogenic eosinophils and will not affect the IL-5 generated eosinophils required for maintaining innate immunity. We present a summarized schematic mechanistic diagram involving NLRP3 and caspase1-regulated IL-18 for EoE pathogenesis (Fig. 8).

**Fig. 8: Proposed pathway of macrophage- and epithelial cell-derived NLRP3-induced IL-18-mediated EoE pathogenesis.**

Methods

Mice

Balb/c, C57BL/6, GM-CSF^−/−, and IL-18^−/− (Balb/c) mice most of the mice are maintained in our laboratory except GM-CSF gene-deficient mice that were obtained from the Jackson Laboratory and housed in a pathogen-free environment. All investigations were carried out on 6- to 8-week-old mice that were age and gender matched. The animal methods were following National Institutes of Health (NIH) recommendations and approved by the Tulane Institutional Animal Care and Use Committee (IACUC). Based on the availability of corresponding gene-deficient mice, we used both C57BL/6 or Balb/c strains of mice.

Study population

The tissue biopsies were collected from the Tulane Eosinophilic Disorder Center and Vanderbilt University School of Medicine. Human EoE biopsies were evaluated using data collected from both centers and combined. Patients with EoE were phenotyped based on endoscopic findings employing the EoE Endoscopic Reference Score (EREFS), a validated endoscopic tool to distinguish EoE from non-EoE conditions. As per the AGREE 2018 guidelines, an eosinophil count of ≥15/HPF (high-power field) in at least one of multiple esophageal biopsy samples taken from different locations is clinically indicative of EoE. Patients were excluded if they had been previously diagnosed with any other type of inflammatory gastrointestinal or systemic illness besides eosinophilic gastrointestinal disorder. Following an IRB-approved methodology, patients with EoE symptoms were included in the biomarker investigation. The patients’ details are provided in Supplementary Table 1.

EoE induction in mice

EoE was induced in the lab using well-established Aspergillus fumigatus⁵¹ or corn allergen²⁹ challenge procedures as describe in our previously published manuscript. Established methodologies were employed to study the role of macrophages in the EoE mouse model employing C57BL/6 or Balb/c, GM-CSF^−/−, IL-18^−/− and their corresponding control mice strains⁵¹. Micropipettes were used to administer 100 µg of Aspergillus fumigatus extract (A. fumigatus) or normal saline (50 µl) to the mice, who were kept in the horizontal posture while being sedated with isoflurane (Iso-Flo; Abbott Laboratories, North Chicago, IL). Mice were sacrificed 18–20 h following the last intranasal allergen or saline exposure after 3 weeks of three challenges per week. Further, a mouse model of corn allergen-induced EoE was induced in lightly anesthetized mice with isoflurane (Iso-Flo; Abbott Laboratories, North Chicago, IL) and sensitized with 200 μg of corn extract (Greer Laboratories, Lenoir, NC) with 1 mg of alum on day 0 and day 14 by intraperitoneal (IP) injection. On day 21, mice were divided into four groups. Two groups were treated intranasally with 100 μg (50 μl) of corn extract (Greer Laboratories) or 50 μl of normal saline alone on days 21, 23, and 25 using a micropipette and were euthanized 20–24 h after the last allergen or saline challenge. The same protocol was used for the two NLRP3 inhibitors at a dose of 10 mg/kg/week for MCC950 and 250 mg/kg for BHB along with the Aspergillus fumigatus or corn extract.

Intravenous injection of rTL-18 in GATA1-deficient mice

rIL-18 (10 µg) was given to Balb/c and GATA1-deficient mice for a period of 2 weeks. A total of six intravenous (i.v.) injections were given, after which the mice were sacrificed, and esophagus collected for further studies.

Anti-IL-18 neutralization antibody treatment

Prior to exposure to Aspergillus extract (100 µg), mice were given Anti-IL-18 Clone YIGIF74-1G7 intraperitoneally (200 µg, twice weekly for 3 weeks) (Bio X Cell, West Lebanon, NH).

Primary esophageal macrophage culture and treatment with rIL-18

To eliminate all epithelial cells and intraepithelial lymphocytes, the esophagus was opened longitudinally and treated with PBS on an orbital shaker at 250 rpm for 2–3 times for 20 min at 37 °C. The esophageal strips will then be chopped and digested in a Patri dish with 10 ml of pre-warmed collagenase VIII/DNAse I solution. Keep the dish horizontally on an orbital shaker and digest the esophagi for 10–20 min at 37 °C at 200 rpm. To ensure full dissociation, vortex the residual esophagi for 5–10 s before filtering through a 100 µm cell strainer straight into a 50 ml conical tube. Then, add CMF HBSS/FBS to the 50 ml conical tube and centrifuge for 5 min at 4 °C at 1500 rpm. The washing stage with CMF HBSS/FBS was repeated one more, and then red blood cells were extracted from the cell pellet using RBC lysis buffer (Sigma). We resuspended the cell pellets in ice-cold CMF, HBSS/FBS after removing the supernatant and put them on ice for some time. For the analysis, the macrophages were cultured overnight and treated with rIL-18.

Primary esophageal epithelial cells and treatment with rIL-18

The mice were sacrificed and esophagus from proximal to distal was removed. Each esophagus was opened longitudinally, washed with Ca- and Mg-free PBS, pH 7.2, and cut into small pieces that were subsequently pooled. The pooled tissue was incubated 40 min in 2 ml of RPMI tissue culture media (GIBCO) with 0.5 mg/ml Liberase Chloride (Rush Biochemicals) in 0.5% CO₂ at 370 °C. After digestion, single cells were isolated and filtered through a 70 μm cell strainer followed by a 40 μm cell strainer (BD Falcon). Cells were centrifuged at 250 × g for 5 min, and cell pellets were resuspended in the media and counted.

Western blot analysis

The esophagus was homogenized and solubilized in Protein Extraction Reagent (Thermo Fisher Scientific, 78510) containing protease inhibitor cocktail and phosphatase inhibitor (Thermo Fisher Scientific, A32953). Proteins (30 μg) were resolved on 4–15% MP TGX Gel (Bio-Rad) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). The antibody of used were listed: Rabbit anti-NLRP3 (1:1000, Cell Signaling Technology, 15101S), rabbit anti-pNLRP3 (Phospho-Ser295) (1:1000, MyBioSource, Inc., MBS9430199), rabbit anti-caspase-1 antibody (1:1000, Cell Signaling Technology, #24232S), anti-caspase-1 (p20) antibody (1:1000, Adipogen life sciences, AG-20B-0042-C100), rabbit anti-IL-18 antibody (1:1000, Biorbyt, orb345221), anti-EPX antibody (1:1000, Mayo Clinic, 662008-1003), anti-IL-1β antibody (1:1000, Cell Signaling Technology, #12242), anti-TGFβ antibody (1:1000, Cell Signaling Technology, 3711S) and rabbit ani-GAPDH (1:1000, Cell Signaling Technology, 5174S).

Quantification of eosinophils

As published earlier, paraffin-embedded esophageal tissue slices (5 µm) were immunostained with antiserum against mouse eosinophil major basic protein (anti-MBP)⁵². In brief, endogenous peroxidase was quenched in tissues using 0.3% hydrogen peroxide in methanol, followed by non-specific protein blocking using 3% normal goat serum. Tissue slices were then treated overnight at 4 °C with rat anti-MBP antibody (1:1000 dilution) (Mayo Clinic, Scottsdale, AZ), followed by 1 h incubation with a 1:250 dilution of biotinylated goat anti-rat IgG secondary antibody and avidin-peroxidase complex (Vector Laboratories, Burlingame, CA). DAB (Vector Laboratories, Burlingame, CA) was used to develop the slides further, and nuclear fast red was used as a counterstain. Specimens were deparaffinized and mounted with mounting media. The quantity of eosinophils and the size of the tissue segment were quantified and computed using digital morphometric analysis (Lumenera Corporation, Infinity Analyze 61.0) and were expressed as eosinophils/mm².

Immunohistochemistry analysis

Immunohistochemical staining of mouse tissue slices (5 µm) was used to identify specific protein antigens in the esophagus. Endogenous peroxidase was blocked by incubating sections in 3.0% H₂O₂ in methanol for 20 min before blocking with 3.0% goat serum for an hour at room temperature. Three primary antibodies were used: TGF-β (1:200, sc-146, Santa Cruz), Ki-47 (1:200, D3B5, CST). The sections were then incubated at 4 °C overnight with the primary antibodies. After an additional hour of incubation with corresponding biotinylated secondary antibodies, the sections were developed with DAB (vector laboratories), counterstained with nuclear fast red, and mounted with mounting media before being analyzed. An Olympus BX43 optical microscope was used to obtain images (Tokyo, Japan).

Immunofluorescence analysis

Sections of paraffin-embedded mouse esophagus tissue (5 m) were deparaffinized and dehydrated, and staining was performed as previously reported⁵³. Antigen retrieval was performed using the Citric Acid-based Antigen Unmasking Solution (Vector labs) method, followed by blocking with 5% normal goat serum to reduce non-specific binding and incubation with specific primary antibodies: anti-F4/80 (1:200, Cell Signaling Technology, 30325S); Rabbit anti-NLRP3 (1:200, Cell Signaling Technology, 15101S); anti-IL-18 (1:200, Invitrogen, HL1859); anti-Cytokeratin antibody (1:400, Cell Signaling Technology, 4545). ProLong Gold Antifade Mountant with DAPI was used to mount immunostained sections (P36980, Thermo Fisher Scientific). Photos were taken using an Olympus BX43 microscope equipped with the proper filters.

Tissue collagen analysis

Collagen staining was performed on tissue sections using Masson’s trichrome staining (Poly Scientific R&D) method for detecting collagen fibers as directed by the manufacturer. An Olympus BX43 microscope was used to obtain the images. The collagen positive area was assessed morphometrically using Olympus Cell Sens Dimension software and is expressed in square microns.

RNA isolation and quantitative transcript analysis by polymerase chain reaction (qPCR)

To extract mRNA from esophageal tissues, we used the RNeasy Mini kit as per the instruction manual (217604, Qiagen, USA). About 500 ng of RNA was converted into cDNA using iscript reverse transcriptase (1708891, Bio-Rad, Hercules, CA). CFX96 Real-Time PCR System was used to amplify cDNA using SYBR Green PCR Master Mix (1725271, Bio-Rad, USA). The following primers were used: mouse 18s rRNA F: GCAATTATTCCCCATGAACG, R: GGCCTCACTAAACCATCCAA; mouse IL-4 F: CCTCACAGCAACGAAGAACA, R: CTGCAGCTCCATGAGAACAC; mouse IL-5 F: TCAGCTGTGTCTGGGCCACT, R: TTATGAGTAGGGACAGGAAGCCTCA; mouse IL-13 F: TGCTTGCCTTGGTGGTCTC, R: CAGGTCCACACTCCATACC; mouse IL-18 F: CTGGCTGTGACCCTCTCTGTGAAG, R: TGTCCTGGAACACGTTTCTGAAAG; mouse NLRP3 F: AGTGGATGGGTTTGCTGGGATA, R: CTGCGTGTAGCGACTGTTGAGGT; mouse F4/80 F: CTTTGGCTATGGGCTTCCAGTC, R: GCAAGGAGGACAGAGTTTATCGTG, human CD163 F: ACATAGATCATGCATCTGTCATTTG, R: CATTCTCCTTGGAATCTCACTTCTA, human NLRP3 F: CTTCTCTGATGAGGCCCAAG, R: GCAGCAAACTGGAAAGGAAG; human IL-18 F: GCTTGAATCTAAATTATCAGTC, R: CAAATTGCATCTTATTATCATG; human GAPDH F: GGAAATCCCATCACCATCT, R: GTCTTCTGGGTGGCAGTGAT.

Statistics and reproducibility

Animals were randomized into different groups and at least 6–8 mice were used for each group. The data are presented as mean ± SD. Student’s t test was used for statistical evaluations of two group comparisons. Statistical analysis with more than two groups was performed with one-way analysis of variance (ANOVA). All statistical analyses were performed with Prism software (GraphPad prism for windows, version 8.0). Differences were considered significant at *p < 0.05, **p < 0.01, ***p < 0.001.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The data generated or analyzed during this study are provided in the main paper (Figs. 1–8) and Supplementary figures (Supplementary Figs. 1–9). The original blot images are shown in Supplementary Figs. 10–13. The source data for the graphs and images can be found in the Supplementary Excel files (Supplementary Data).

References

Rothenberg, M. E., Mishra, A., Brandt, E. B. & Hogan, S. P. Gastrointestinal eosinophils in health and disease. Adv. Immunol. 78, 291–328 (2001).
Article CAS PubMed Google Scholar
Mishra, A., Hogan, S. P., Brandt, E. B. & Rothenberg, M. E. An etiological role for aeroallergens and eosinophils in experimental esophagitis. J. Clin. Invest. 107, 83–90 (2001).
Article CAS PubMed PubMed Central Google Scholar
Attwood, S. E. & Furuta, G. T. Eosinophilic esophagitis: historical perspective on an evolving disease. Gastroenterol. Clin. North Am. 43, 185–199 (2014).
Article PubMed PubMed Central Google Scholar
Lucendo, A. J. et al. Eosinophilic esophagitis in adults: an emerging disease. Dig. Dis. Sci. 49, 1884–1888 (2004).
Article PubMed Google Scholar
Croese, J. et al. Clinical and endoscopic features of eosinophilic esophagitis in adults. Gastrointest. Endosc. 58, 516–522 (2003).
Article PubMed Google Scholar
Ruigomez, A., Alberto Garcia Rodriguez, L., Wallander, M. A., Johansson, S. & Eklund, S. Esophageal stricture: incidence, treatment patterns, and recurrence rate. Am. J. Gastroenterol. 101, 2685–2692 (2006).
Article PubMed Google Scholar
Zimmerman, S. L. et al. Idiopathic eosinophilic esophagitis in adults: the ringed esophagus. Radiology 236, 159–165 (2005).
Article PubMed Google Scholar
Dellon, E. S. et al. ACG clinical guideline: evidenced based approach to the diagnosis and management of esophageal eosinophilia and eosinophilic esophagitis (EoE). Am. J. Gastroenterol. 108, 679–692 (2013).
Article PubMed Google Scholar
Dellon, E. S. et al. Updated international consensus diagnostic criteria for eosinophilic esophagitis: proceedings of the AGREE conference. Gastroenterology 155, 1022–1033.e10 (2018).
Article PubMed Google Scholar
Sampson, H. A. Food allergy. JAMA 278, 1888–1894 (1997).
Article CAS PubMed Google Scholar
Guajardo, J. R. & Rothenberg, M. E. in Food Allergy: Adverse Reactions to Foods and Additives (eds Metcalfe, D. D., Sampson, H. A. & Simon, R. A.) 217–226 (Blackwell Publishing, 2003).
Sampson, H. A. Update on food allergy. J. Allergy Clin. Immunol. 113, 805–819 (2004).
Article CAS PubMed Google Scholar
Sherrill, J. D. et al. Analysis and expansion of the eosinophilic esophagitis transcriptome by RNA sequencing. Genes Immun. https://doi.org/10.1038/gene.2014.27 (2014).
Sherrill, J. D. & Rothenberg, M. E. Genetic and epigenetic underpinnings of eosinophilic esophagitis. Gastroenterol. Clin. North Am. 43, 269–280 (2014).
Article PubMed PubMed Central Google Scholar
Niranjan, R. et al. Involvement of interleukin-18 in the pathogenesis of human eosinophilic esophagitis. Clin. Immunol. 157, 103–113 (2015).
Article CAS PubMed PubMed Central Google Scholar
Mishra, A., Hogan, S. P., Brandt, E. B. & Rothenberg, M. E. IL-5 promotes eosinophil trafficking to the esophagus. J. Immunol. 168, 2464–2469 (2002).
Article CAS PubMed Google Scholar
Venkateshaiah, S. U. et al. A critical role for IL-18 in transformation and maturation of naive eosinophils to pathogenic eosinophils. J. Allergy Clin. Immunol. 142, 301–305 (2018).
Article CAS PubMed PubMed Central Google Scholar
Mishra, A., Majid, D., Kandikattu, H. K., Yadavalli, C. S. & Upparahalli Venkateshaiah, S. Role of IL-18-transformed CD274-expressing eosinophils in promoting airway obstruction in experimental asthma. Allergy 77, 1165–1179 (2022).
Article CAS PubMed Google Scholar
Paget, C., Doz-Deblauwe, E., Winter, N. & Briard, B. Specific NLRP3 inflammasome assembling and regulation in neutrophils: relevance in inflammatory and infectious diseases. Cells 11, 1188 (2022).
Article CAS PubMed PubMed Central Google Scholar
Xiao, Y., Xu, W. & Su, W. NLRP 3 inflammasome: a likely target for the treatment of allergic diseases. Clin. Exp. Allergy 48, 1080–1091 (2018).
Article CAS PubMed Google Scholar
Zahid, A., Li, B., Kombe, A. J. K., Jin, T. & Tao, J. Pharmacological inhibitors of the NLRP3 inflammasome. Front. Immunol. 10, 2538 (2019).
Coll, R. C. et al. A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases. Nat. Med. 21, 248–255 (2015).
Article CAS PubMed PubMed Central Google Scholar
Youm, Y.-H. et al. The ketone metabolite β-hydroxybutyrate blocks NLRP3 inflammasome-mediated inflammatory disease. Nat. Med. 21, 263–269 (2015).
Article CAS PubMed PubMed Central Google Scholar
Mishra, A. & Rothenberg, M. E. Intratracheal IL-13 induces eosinophilic esophagitis by an IL-5, eotaxin-1, and STAT6-dependent mechanism. Gastroenterology 125, 1419–1427 (2003).
Article CAS PubMed Google Scholar
Ko, E. & Chehade, M. Biological therapies for eosinophilic esophagitis: where do we stand? Clin. Rev. Allergy Immunol. 55, 205–216 (2018).
Article CAS PubMed Google Scholar
Assa’ad, A. H. et al. An antibody against IL-5 reduces numbers of esophageal intraepithelial eosinophils in children with eosinophilic esophagitis. Gastroenterology 141, 1593–1604 (2011).
Article PubMed Google Scholar
Dellon, E. S. et al. Dupilumab in adults and adolescents with eosinophilic esophagitis. N. Engl. J. Med. 387, 2317–2330 (2022).
Article CAS PubMed Google Scholar
Niranjan, R. et al. Pathogenesis of allergen-induced eosinophilic esophagitis is independent of interleukin (IL)-13. Immunol. Cell Biol. 91, 408–415 (2013).
Article CAS PubMed PubMed Central Google Scholar
Rajavelu, P., Rayapudi, M., Moffitt, M., Mishra, A. & Mishra, A. Significance of para-esophageal lymph nodes in food or aeroallergen-induced iNKT cell-mediated experimental eosinophilic esophagitis. Am. J. Physiol. Gastrointest. Liver Physiol. 302, G645–G654 (2012).
Article CAS PubMed Google Scholar
Lam, A. Y., Ma, C., Lee, J. K. & Bredenoord, A. J. Eosinophilic esophagitis: new molecules, better life? Curr. Opin. Pharmacol. 63, 102183 (2022).
Article CAS PubMed Google Scholar
Dellon, E. S. & Hirano, I. Epidemiology and natural history of eosinophilic esophagitis. Gastroenterology 154, 319–332. e313 (2018).
Article PubMed Google Scholar
Arias, Á. & Lucendo, A. J. Epidemiology and risk factors for eosinophilic esophagitis: lessons for clinicians. Expert Rev. Gastroenterol. Hepatol. 14, 1069–1082 (2020).
Article CAS PubMed Google Scholar
Gomez Torrijos, E. et al. Eosinophilic esophagitis: demographic, clinical, endoscopic, histologic, and atopic characteristics of children and teenagers in a region in central Spain. J. Investig. Allergol. Clin. Immunol. 27, 104–110 (2017).
Article CAS PubMed Google Scholar
de Groot, A. E. et al. Targeting interleukin 4 receptor alpha on tumor-associated macrophages reduces the pro-tumor macrophage phenotype. Neoplasia 32, 100830 (2022).
Article PubMed PubMed Central Google Scholar
Manohar, M., Kandikattu, H. K., Upparahalli Venkateshaiah, S., Yadavalli, C. S., & Mishra, A. Eosinophils in the pathogenesis of pancreatic disorders. Semin Immunopathol. 43, 411–422 (2021).
Blanchard, C. et al. Eotaxin-3 and a uniquely conserved gene-expression profile in eosinophilic esophagitis. J. Clin. Investig. 116, 536–547 (2006).
Article CAS PubMed PubMed Central Google Scholar
Dutt, P. et al. Allergen‐induced interleukin‐18 promotes experimental eosinophilic oesophagitis in mice. Immunol. Cell Biol. 93, 849–857 (2015).
Article CAS PubMed PubMed Central Google Scholar
Kandikattu, H. K., Venkateshaiah, S. U. & Mishra, A. Synergy of Interleukin (IL)-5 and IL-18 in eosinophil mediated pathogenesis of allergic diseases. Cytokine Growth Factor Rev. 47, 83–98 (2019).
Article CAS PubMed PubMed Central Google Scholar
Verma, A. K. et al. Intestinal overexpression of il‐18 promotes eosinophils‐mediated allergic disorders. Immunology 157, 110–121 (2019).
Article CAS PubMed PubMed Central Google Scholar
Lyles, J. & Rothenberg, M. Role of genetics, environment, and their interactions in the pathogenesis of eosinophilic esophagitis. Curr. Opin. Immunol. 60, 46–53 (2019).
Article CAS PubMed PubMed Central Google Scholar
Mishra, A. Mechanism of eosinophilic esophagitis. Immunol. Allergy Clin. North Am. 29, 29–40 (2009).
Article PubMed PubMed Central Google Scholar
Mishra, A., Hogan, S. P., Lee, J. J., Foster, P. S. & Rothenberg, M. E. Fundamental signals that regulate eosinophil homing to the gastrointestinal tract. J. Clin. Investig. 103, 1719–1727 (1999).
Article CAS PubMed PubMed Central Google Scholar
Mishra, A. Long term Th2 cytokines immunotherapy beneficial for EoE pediatric patients? Int. J. Public Health Aware. 5, 9–11 (2022).
PubMed PubMed Central Google Scholar
Siegle, J. S. et al. Airway hyperreactivity in exacerbation of chronic asthma is independent of eosinophilic inflammation. Am. J. Respir. Cell Mol. Biol. 35, 565–570 (2006).
Article CAS PubMed Google Scholar
Gadani, S. P., Cronk, J. C., Norris, G. T. & Kipnis, J. IL-4 in the brain: a cytokine to remember. J. Immunol. 189, 4213–4219 (2012).
Article CAS PubMed Google Scholar
Simon, A. K., Hollander, G. A. & McMichael, A. Evolution of the immune system in humans from infancy to old age. Proc. Biol. Sci. 282, 20143085 (2015).
PubMed PubMed Central Google Scholar
Niranjan, R., Thakur, A. K. & Mishra, A. Food allergy and eosinophilic esophagitis in India: lack of diagnosis. Indian J. Gastroenterol. 35, 72–73 (2016).
Article PubMed Google Scholar
Liu, L.-l. et al. Prim-O-glucosycimifugin attenuates liver injury in septic mice by inhibiting NLRP3 inflammasome/caspase-1 signaling cascades in macrophages. Phytomedicine 106, 154427 (2022).
Article CAS PubMed Google Scholar
Zhao, W. et al. Nrf2 and NF-κB/NLRP3 inflammasome pathways are involved in Prototheca bovis infections of mouse mammary gland tissue and mammary epithelial cells. Free Radic. Biol. Med. 184, 148–157 (2022).
Article CAS PubMed Google Scholar
Mishra, A., Schlotman, J., Wang, M. & Rothenberg, M. E. Critical role for adaptive T cell immunity in experimental eosinophilic esophagitis in mice. J. Leukoc. Biol. 81, 916–924 (2007).
Article CAS PubMed Google Scholar
Upparahalli Venkateshaiah, S., Manohar, M., Kandikattu, H. K. & Mishra, A. Experimental modeling of eosinophil-associated diseases. Eosinophils: Methods and Protocols 275–291 (2021).
Kandikattu, H. K., Venkateshaiah, S. U., Verma, A. K. & Mishra, A. Tacrolimus (FK506) treatment protects allergen‐, IL‐5‐and IL‐13‐induced mucosal eosinophilia. Immunology 163, 220–235 (2021).
Article CAS PubMed PubMed Central Google Scholar
Kandikattu, H. K. et al. Macrophages-induced IL-18–mediated eosinophilia promotes characteristics of pancreatic malignancy. Life Sci. Alliance 4, e202000979 (2021).
Article CAS PubMed PubMed Central Google Scholar

Download references

Acknowledgements

A.M. is the endowed Schleiden Chair; therefore, we thank the Edward G. Schleifer Educational Foundation for their support. This work was supported by the National Institute of Health (NIH) of USA (NIH grant R01 AI080581, A.M.). The authors are thankful to Lunar Biotechnology, LLC for their efforts and their collaboration in performing some experiments. Authors are also thankful to Ms. Loula Burton, Editor for the Office of Research Proposal Development, Tulane University for the proofreading and editing of the manuscript.

Author information

Authors and Affiliations

John W. Deming Department of Medicine, Tulane Eosinophilic Disorders Center (TEDC), Section of Pulmonary Diseases, Tulane University School of Medicine, New Orleans, LA, USA
Chandra Sekhar Yadavalli, Sathisha Upparahalli Venkateshaiah, Sandeep Kumar, Hemanth Kumar Kandikattu, Lokanatha Oruganti, Chandra Sekhar Kathera & Anil Mishra
Department of Medicine, Medical College of Georgia, Augusta University, Augusta, GA, USA
Sandeep Kumar
Department of Pharmacology, Tulane University School of Medicine, New Orleans, LA, USA
Lokanatha Oruganti

Authors

Chandra Sekhar Yadavalli
View author publications
Search author on:PubMed Google Scholar
Sathisha Upparahalli Venkateshaiah
View author publications
Search author on:PubMed Google Scholar
Sandeep Kumar
View author publications
Search author on:PubMed Google Scholar
Hemanth Kumar Kandikattu
View author publications
Search author on:PubMed Google Scholar
Lokanatha Oruganti
View author publications
Search author on:PubMed Google Scholar
Chandra Sekhar Kathera
View author publications
Search author on:PubMed Google Scholar
Anil Mishra
View author publications
Search author on:PubMed Google Scholar

Contributions

C.S.Y.: mouse data generation and experimental analysis, immunofluorescence, immunohistochemistry, immunoblot, ELISA, and initial manuscript draft; S.U.V.: human tissue experimental data generation and analysis; S.K.: initial mouse experiments and tissue immunostaining; L.O.: tissue processing, section cutting, and ELISA analysis; H.K.K.: editing and review of manuscript; C.S.K.: PCR analysis, manuscript editing; A.M.: conceptualization, experimental planning, visualization, review, supervision, and provision of funds.

Corresponding author

Correspondence to Anil Mishra.

Ethics declarations

Competing interests

The authors declare that they have no known competing personal relationships that could have appeared to influence the work reported in this paper. However, A.M. filed a patent to protect using humanized antagonist or anti-antibody of NLRP3-Caspase1-IL-18 for targeting human eosinophils associated disease pathogenesis.

Peer review

Peer review information

Communications Biology thanks Matt Johansen and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Primary Handling Editor: Joao Valente. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Peer Review File

Supplementary Information

Supplementary Data

Reporting Summary

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Yadavalli, C.S., Upparahalli Venkateshaiah, S., Kumar, S. et al. Allergen-induced NLRP3/caspase1/IL-18 signaling initiate eosinophilic esophagitis and respective inhibitors protect disease pathogenesis. Commun Biol 6, 763 (2023). https://doi.org/10.1038/s42003-023-05130-4

Download citation

Received: 05 January 2023
Accepted: 10 July 2023
Published: 31 July 2023
DOI: https://doi.org/10.1038/s42003-023-05130-4

This article is cited by

Eosinophil recruitment and activation in the central nervous system of patients with subarachnoid neurocysticercosis
- Emily Miltenberger
- Janitzio Guzmán
- Elise M. O’Connell
Journal of Neuroinflammation (2025)
NETs activate the GAS6-AXL-NLRP3 axis in macrophages to drive morphine tolerance
- Qingyan Tian
- Haiyue Guo
- Chun-Yi Jiang
Cell Communication and Signaling (2025)