Fig. 1

Example of genotyping. All animals were genotyped as described in Materials and Methods, using a Jackson Laboratories Kit, by PCR. This is supplied as a kit and uses the probes 5′ATCTCAGCCTTAGGCCCTGT, wild-type forward primer; 5′ATAGATTCGCCCTTGTGTCC, mutant forward primer; 5′TCAAACCCTGTGACAACAGC, common reverse primer. The reactions were done together (that is, with all three probes) to produce 140 bp amplicons from the mutant, 262 bp amplicons from the wild type, and both products in the heterozygotes. Wild-type animals are showing only the larger band (animals 22, 24, 26, and 27 below), and animals with the deletion showing only the smaller band (28 and 29, below). Animals with both bands are heterozygotes (23, 25, and 30 below). Knockouts were verified by absence of the Scarb1 product, by PCR in osteoblasts (see Fig. 7a below)