Correction to: Mucosal Immunology (2018) 11(4): 1047–1059; https://doi.org/10.1038/s41385-018-0014-7; published online 07 March 2018
The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5’ - GCTCCCTCTGCAGTGTTTATT -3’
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
About this article
Cite this article
Al-Attar, A., Alimova, Y., Kirakodu, S. et al. Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA. Mucosal Immunol 12, 1066 (2019). https://doi.org/10.1038/s41385-019-0152-6
Published:
Version of record:
Issue date:
DOI: https://doi.org/10.1038/s41385-019-0152-6
This article is cited by
-
Secretory phospholipase A2-IIA targets bacterial extracellular vesicles to modulate immune signaling
Communications Biology (2025)
