Correction to: Cellular and Molecular Immunology https://doi.org/10.1038/s41423-019-0285-2, Article published online 11 September 2019
In the version of this article initially published, three unintended errors were made during manuscript preparation. (1) The caption of Fig 4a was incorrect, and the correct statement is ‘Effects of SNX8-deficiency on virus-induced death of mice. Mice were infected intraperitoneally (i.p.) with VSV at 5 × 107 pfu per mouse (n = 10 for each genotype) or EMCV at 5 × 106 pfu per mouse (n = 10 for Snx8+/+, n = 11 for Snx8−/−). Mouse survival was observed and recorded for 12 days.’ (2) Fig 2a and Fig 2e were represented erroneously. The correct Fig 2 is shown below. (3) Typos were found in the description of the qPCR primers for GAPDH and IFNB1 in the Material and Method section, the correct primers are 'GAPDH GAGTCAACGGATTTGGTCGT (forward) and GACAAGCTTCCCGTTCTCAG (reverse); IFNB1 TTGTTGAGAACCTC CTGGCT (forward) and TGACTATGGTCCAGGCACAG (reverse)'. The results and conclusions are not affected.

Author information
Authors and Affiliations
Corresponding authors
Rights and permissions
About this article
Cite this article
Guo, W., Wei, J., Zhong, X. et al. Correction to: SNX8 modulates the innate immune response to RNA viruses by regulating the aggregation of VISA. Cell Mol Immunol 18, 1613–1614 (2021). https://doi.org/10.1038/s41423-021-00682-z
Published:
Version of record:
Issue date:
DOI: https://doi.org/10.1038/s41423-021-00682-z