Table 1 Information of strains, plasmids, and oligos used in this study.
Description | Reference | |
|---|---|---|
Strains | ||
B. thuringiensis 407 Cry- (Bt407) | Acrystalliferous B. thuringiensis type strain | |
Bt407 mKate | Bt407 transformed with pTB604 | |
Bt407 FS GFP | Bt407 evolved FS variant from P1 transformed with pTB603 | This study |
Bt407 N mKate | Bt407 evolved N variant from P1 transformed with pTB604 | This study |
Bt407ΔrfbM | Bt407 introduced a deletion mutation of rfbM | This study |
E. coli XL-1 Blue | recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F ́ proAB lacIqZ∆M15 Tn10 (TetR)] | |
Plasmids | ||
pMAD | Shuttle vector, bgaB, bla, ermC (AmpR and EryR) | |
pMAD (I-SceI) | pMAD containing I-SceI digestion site (AmpR and EryR) | |
pBKJ223 | A vector expressing the I-SceI enzyme (AmpR and TetR) | |
pTB603 | pNW33N with Physpank-GFP | |
pTB604 | pNW33N with Physpank-mKATE2 | |
Oligos | ||
oYL51 | Forward oligo to check if a mutation is present in BTB_RS26870 CCGGAATTCTCTAGCTACTCTCACTACT | This study |
oYL52 | Reverse oligo to check if a mutation is present in BTB_RS26870 CGCGGATCCCTAGGGTGAGGAGATAATA | This study |
oYL55 | Forward oligo to amplify left arm of the homologous fragment with EcoRI site CCG GAA TTCAACCTTATAATCCTCATGGG | This study |
oYL56 | Reverse oligo to amplify left arm of the homologous fragment with XbaI site GCTCTAGAGCAATGGAAAGAAATAGAGG | This study |
oYL57 | Forward oligo to amplify right arm of the homologous fragment with XbaI site GCTCTAGATATTATCTCCTCACCCTAGA | This study |
oYL58 | Reverse oligo to amplify right arm of the homologous fragment with BamHI site CGCGGATCCTTATGCTTGGGATTTGCAAC | This study |
oYL49 | Forward oligo for sequencing the insert of multi cloning sites of pMAD TCTATCGATGCATGCCAT | This study |
oYL50 | Reverse oligo for sequencing the insert of multi cloning sites of pMAD AGAATCATAATGGGGAAGG | This study |
qBCE3 | Forward oligo to amplify the housekeeping gene rpoA CGTGGATATGGTACTACTTTGG | |
qBCE4 | Reverse oligo to amplify the housekeeping gene rpoA TTCTACTACGCCCTCAACTG | |
oYL61 | Forward oligo to amplify the housekeeping gene udp ACTAGAGAAACTTGGAAATGATCG | |
oYL62 | Reverse oligo to amplify the housekeeping gene udp GACGCTTAATTGCACGGAAC | |
oYL63 | Forward oligo to amplify the gene manA for RT-qPCR CTTACGGTTCTTAATGTCGC | This study |
oYL64 | Reverse oligo to amplify the gene manA for RT-qPCR CGTATTGATAGTGATGGGAA | This study |
oYL65 | Forward oligo to amplify the gene lytR for RT-qPCR TAGGAGTGCTGATTATTGGT | This study |
oYL66 | Reverse oligo to amplify the gene lytR for RT-qPCR AGAATCTGATCGTCCTACC | This study |