Table 2 Molecular diagnoses reported by variant type
SNVs and indels | ||||||
|---|---|---|---|---|---|---|
ID | Age/gender | Family structurea | Phenotype | Genomic variant(s) {molecular state-inheritance} | Associated condition (phenotype MIM number) | Classificationb |
P1 | 15.5-yo/F | Proband-only | Fatigue, muscle pain, exercise intolerance, abnormal gait- walks leaning forward and drags one foot, frequent falls, asthma, short stature, ptosis, short 5th metacarpals, 5th finger clinodactyly, learning difficulties, aggressive behavior, anxiety, amenorrhea, non-specific abnormal muscle biopsy | CHRNE c.1116_1128delGTCGT CGGTGGGC (p.Ser373TyrfsTer8) {hom-unk} [NM_000080.3] | Congenital myasthenic syndrome (605809); AR | LP |
P2 | 5-yo/M | Duo | DD, severe growth restriction with microcephaly, dysmorphic facies, cortical blindness, constant movement | TSEN54 c.919G>T (p.Ala307Ser) {hom-mat} [NM_207346.2] | Pontocerebellar hypoplasia (277470); AR | P |
P3 | 11-yo/F | Duo | Developmental regression, loss of language, purposeful and repetitive hand movement, scoliosis, mildly ataxic gait, self-injurious behavior | MECP2 c.916C>T p.Arg306Cys {het-unk} [NM_004992.3] | Rett syndrome (312750); AD | P |
P4 | 7.5-yo/M | Duo | DD including speech delay, learning and language impairment, hypotonia, camptodactyly, midface hypoplasia, tubular nose, small mouth, secondary alveolar hyperplasia, abnormal palmar creases | NEB c.7645-1G>C {het-mat} [NM_001271208.1] NEB c.11628G>A (p.Trp3876Ter) {het-unk} [NM_001271208.1] | Nemaline myopathy (256030); AR | LP LP |
P5 | 11.5-yo/M | Duo | DD, ID, expressive speech delay involving regression, short stature, right unilateral cryptorchidism, friendly demeanor with plenty of affection, anxiety | KDM5C c.4006dupC (p.Leu1336ProfsTer11) {hem-DN} [NM_004187.3] | X-linked intellectual disability (300534); XL | LP |
P6 | 12-yo/M | Duo | ID, dysmorphic facies, short fourth metatarsals, obesity, and ADHD | EP300 c.2876G>T (p.Ser959Ile) {het-unk} [NM_001429.3] Secondary finding: 749 kb loss at 7p22.1, including at least exons 1–10 of PMS2 (chr7:6027017-6776186) {het-unk} | Rubinstein–Taybi syndrome (613684); AD Lynch syndrome (614337); AD | VUS LP |
P7 | 9.5-yo/M | Trio | Global DD, microcephaly, seizures, truncal hypotonia, choreoathetoid movements, hand-wringing behaviors, sleep disturbance, dysmorphic facies | FOXG1 c.506delG (p.Gly169AlafsTer23) {het-DN} [NM_005249.4] | Rett-like syndrome (613454); AD | P |
P8 | 5-yo/F | Trio | MRI findings of lissencephaly, agenesis of the corpus callosum, small cerebellum with Dandy–Walker malformation. Severe post-natal growth restriction with microcephaly, global DD, ASD, hearing loss, dysmorphic facies, seizures, scoliosis, hypertonia, spastic quadriplegia | TUBA1A c.1096G>C (p.Gly366Arg) {het-DN} [NM_006009.3] | Lissencephaly (611603); AD | P |
P9 | 13-yo/F | Trio | ID, DD, hypotonia, hemivertebrae, scoliosis, long tapered fingers, broad thumbs, and great toes, hallux valgus, broad columella, tooth abnormalities, and relative prognathism | CTNNB1 c.865_869delACAAA (p.Thr289CysfsTer2) {het-DN} [NM_001904.3] | Syndromic intellectual disability (615075); AD | P |
P10 | 4.5-yo/F | Trio | DD, ID, pre- and post-natal growth deficiency, microcephaly, microtia, atresia of the right ear canal, Pierre-Robin sequence with cleft palate, bilateral ear tags, strabismus, proximal placement of thumbs | EFTUD2 c.1904dupT (p.Tyr636LeufsTer8) {het-DN} [NM_ 004247.3] | Mandibulofacial dysostosis- microcephaly syndrome (610536); AD | P |
P11 | 7-yo/M | Trio | Short stature, severe hip dysplasia with flattening and obliteration of the epiphysis, a small fragmented proximal humeral epiphysis, an increased span to height ratio (1.06), an increased upper to lower segment ratio (1.4), limited elbow extension, asymmetric pectus carinatum, lumbar lordosis, umbilical hernia, tapering calves | COL2A1 c.3121G>A (p.Gly1041Ser) {het- DN} [NM_001844.4] | Type II collagenopathies (120140); AD | P |
P12 | 4.5-yo/M | Trio | DD, FTT, microcephaly, recurrent infections, sleep apnea, bilateral eye abnormalities including blepharophimosis and epicanthal folds, cup-shaped ears with a right ear tag, smooth philtrum, bilateral single transverse palmar creases and hypoplastic thenar creases, diastasis recti, hydrocele, pigmentary abnormalities | UBE3B c.518C>A (p.Ser173Ter) {het-mat} [NM_130466.3] UBE3B c.61G>T (p.Glu21Ter) {het-pat} [NM_130466.3] Secondary finding: BRCA2 c.658_659delGT (p.Val220IlefsTer4) {het-mat} [NM_000059.3] | Kaufman oculocerebrofacial syndrome (244450); AR Hereditary breast and ovarian cancer syndrome (612555); AD | P P P |
P13 | 4.5-yo/M | Trio | Striking ataxia, epilepsy, regression of speech and motor ability with onset around age 3 | TPP1 c.379C>T (p.Arg127Ter) {het-mat} [NM_000391.3] TPP1 c.1496dupC (p.Leu500SerfsTer18) {het-pat} [NM_000391.3] | Neuronal ceroid lipofuscinosis disease (204500); AR | P P |
P14 | 3-yo/M | Trio | Psychomotor delay, speech delay, low anterior hairline, minor plagiocephaly, broad nasal tip, mild 5th finger clinodactyly, shawl scrotum, inappropriate laughter, wide-based gait | NAA15 c.382C>T (p.Arg128Ter) {het-DN} [NM_057175.3] | Intellectual disability (617787); AD | P |
P15 | 17.5-yo/M | Trio | DD, ID, growth delay, mild microcephaly, dysmorphic facies, low hair line, short neck, decrease elbow mobility, prominent fetal pads, cryptorchidism, constipation | KMT2A c.3034C>T (p.Gln1012Ter) {het- DN} [NM_001197104.1] | Wiedemann Steiner syndrome (605130); AD | P |
P16 | 21.5-yo/F | Trio | ID, expressive language delay, hydronephrosis, bilateral hip dysplasia, septal hypertrophy and cardiomyopathy, coarse facies, maxillary hypoplasia, thick curly hair, hypoplastic distal phalanges with thick knuckles and small nails, redundant and loose skin on hands | HRAS c.34G>A (p.Gly12Ser) {het-DN} [NM_005343.2] | Costello syndrome (218040); AD | P |
P17 | 1.5-yo/F | Trio | Epilepsy, appendicular hypertonia, axial hypotonia, feeding difficulties, constipation, short sternum, one adducted and short thumb, clinodactyly of the second fingers and second toes, syndactyly on both hands, absence of distal creases | CACNA1G c.4591A>G (p.Met1531Val) {het-DN} [NM_018896.4] | CACNA1G-related Disorders (616795); AD | LP |
P18 | 12-yo/F | Trio | Global DD with absent speech, behavioral issues, feeding difficulties, post-natal growth retardation with microcephaly, seizures, ASD | SMARCA4 c.2678T>G (p.Leu893Arg) {het-DN} [NM_001128849.1] | Coffin-Siris syndrome (614609); AD | LP |
P19 | 16-yo/F | Trio | ID, DD (motor and speech delay with progressive selective mutism), self- aggressive behavior, severe anxiety, social avoidance, short stature, scoliosis, high pain tolerance, dysmorphic features, mild micrognathia, joint hypermobility, small hands, brachydactyly with hypoplastic distal phalanges of all fingers and very short fourth and especially fifth metacarpals and metatarsals. | HDAC8 c.943T>A (p.Trp315Arg) {het-DN} [NM_018486.2] | Cornelia de Lange syndrome (300882); XLD | LP |
P20 | 14-yo/M | Quad (with affected 4 yo brother and affected father) | Proband: Primary microcephaly, seizures, ID, attention deficit Affected Brother: Primary microcephaly and seizures, ptosis, astigmatism, nystagmus, epicanthal folds, posterior parietal hair whorls, a large incisor, smooth philtrum, and a single transverse palmar crease. Father: Microcephaly | KIF11 c.308+1G>A, {het-pat} [NM_004523.3] | Microcephaly with or without chorioretinopathy, lymphedema, or intellectual disability (152950); AD | VUS |
Aneuploidies and UPD | ||||||
|---|---|---|---|---|---|---|
ID | Age/gender | Family structurea | Phenotype | Genomic variant(s) | Associated condition (phenotype MIM number) | Classificationb |
P21 | 4.5-yo/F | Duo | Global DD, ataxia, dysmorphic facies, facial asymmetry while crying, feeding difficulties, aggressive behavior | Depth of 4× on p-arm of chr18 | Tetrasomy 18p (614290) | P |
P22 | 1.5-yo/F | Trio | Multiple congenital anomalies, hypomelanosis of Ito | Depth of 2.47× on chr14c | Mosaic trisomy 14 | P |
P23 | 4-yo/F | Trio | Global DD, dysmorphic facies, broad- based ataxic gait | UPD of chr15 {pat} | Angelman syndrome (105830) | P |
CNVs and derivative chromosomes | ||||||
|---|---|---|---|---|---|---|
ID | Age/gender | Family structurea | Phenotype | Genomic variant(s) {inheritance} | Associated condition (phenotype MIM number) | Classificationb |
P24 | 11-yo/M | Duo | DD, ID, FTT, dysmorphic facies, cleft palate, tapered fingers, PDA, hypoplastic nails | 6.6 Mb loss at 2q36.1-q37.3, mosaic (chr2:236478472-243048854)d 2.7 Mb gain at 3q29, mosaic (chr3:195106447-197846145)d | Derivative chromosome 2, including 2q37 microdeletion syndrome | P |
P25 | 5-yo/F | Duo | DD, ID with expressive language delay, behavioral issues, joint laxity, loose skin, easy bruising, low tone, dysmorphic facies, bifid uvula, two supernumerary nipples, diastasis recti, overlapping toes, flat feet, a single transverse palmar crease, prominent finger pads on her right hand, 4th finger clinodactyly, decreased fetal movement in prenatal stage with dorsiflexion of the feet and fisted hands at birth | 510.8 kb loss at 21q22.3 (chr21:47590586-48101334) 34.4 Mb gain at 3p26.3-p22.3 (chr3:60000-34461438) | Derivative chromosome 21, including partial trisomy 3p syndrome | P |
P26 | 9.5-yo/M | Duo | Growth restriction with microcephaly, ID, absent speech, hyperactivity, dysmorphic facies, seizures | 15.5 Mb loss at 6q21-22.31 (chr6:109324789-124836619) {unk} 2.5 Mb loss at 6q22.33-23.2 (chr6:129969121-132499298) {unk} 1.95 Mb gain at 11p15.4 (chr11:8548056-10497905) {unk} | Acro-cardio-facial syndrome (6q21-6q22.1 deletion); complex chromosomal change Complex chromosomal change Complex chromosomal change | P VUS VUS |
P27 | 15-yo/M | Duo | DD, ID, recurrent infections, cryptorchidism, mild hearing loss, mild autistic behavior, crowded teeth, micrognathia, second toe overlaps the first toe on both feet | 3.48 Mb gain at 1q22-q23.2 (chr1:155709113-159191078) {unk} | Disease association NOS | VUS-LP |
P28 | 3-yo/F | Trio | DD, FTT, PDA with pulmonary hypertension, poor growth with microcephaly, dysmorphic facies, including bilateral 5th finger clinodactyly, hypoplastic nails, protuberant and anteverted ears, short and broad hands and feet, excessive sweating, feeding difficulties | 3.78 Mb loss at 15q26.3 (chr15:98615561-102400033) 15.21 Mb gain at 13q32.2q34 (chr13:99892724-115108414) | Derivative chromosome 15 | P |
P29 | 9-yo/M | Trio | ID, hypotonia, growth deficiency, microcephaly with sagittal and metopic craniosynostosis, two anterior hair whorls, large malformed ears with narrow canals, dysmorphic facies, bilateral 2,3,4 campodactyly, bulbous toes, a short left fourth metatarsal, contracted knees, one kidney smaller than the other, cryptorchidism | 18.3 Mb loss at 1p36.12-36.32 (chr1:4436802-22782007) {DN} | 1p36 deletion syndrome (607872) | P |
P30 | 4.5-yo/F | Trio | ID, DD, aggressive behavior, anxiety, macrocephaly, dysmorphic facies, hypertrichosis, large hands, large ears, MRI findings of an increase in extra-axial space and dilatation of the Virchow–Robin space | 2 Mb loss at 5q35.2-35.3 (chr5:175470000-177450000) {DN} | Sotos syndrome (117550) | P |
P31 | 20-yo/M | Trio | Expressive speech delay, learning disabilities, hypertrophic cardiomyopathy, telangiectasia, facial flushing, acroparesthesia, joint pain, headaches | 5.1 Mb gain at 8p23.1 (chr 8: 7153587-12245784)e {DN} | 8p23.1 duplication syndrome | P |
P32 | 1-yo/F | Trio | Gross motor DD, prenatal growth restriction, FTT, striking generalized hypotonia with head lag, ASD with pulmonary insufficiency, mild nasopharyngeal reflux, dysmorphic facies, bilateral shoulder dimples, small hands with prominent fetal pads, bilateral single transverse palmar creases, tapered fingers, bilateral fifth finger clinodactyly, small and puffy feet | 5.76 Mb loss at 14q32.31-14qter (chr14:101522804-107289470) {DN} | 14q32.3 terminal deletion syndrome | P |
P33 | 10.5/F | Trio | DD, ID, hypotonia, dysmorphic facies, partial 2–3 and 3–4 syndactyly of the hands, astigmatism, anterior crossbite, sleep apnea | 2.4 Mb loss at 1q42.2-42.3 (chr1:234117880-236536349) {DN} | 1q4 deletion syndrome | P |
P34 | 5.5-yo/M | Trio | DD, bilateral club feet, inguinal and umbilical hernias, aplasia cutis congenita, spina bifida occulta, dysmorphic facies, long fingers, and small patellas which are dislocated to the left | 9.86 Mb loss at 5q23.2-q31.1 (chr5:124864529-134720575) {DN} | 5q22-q31 deletion syndrome | P |
P35 | 1-yo/M | Trio (with affected father) | FTT, dysmorphic facies, mild retrognathia, low set ears, small hands with brachydactyly, fifth finger clinodactyly, and persistent fetal pads, infantile acne, large hypopigmented spot on abdomen | 2.3 Mb loss at 1q24.2-25.1 (chr1:170777501-173113232) {pat} | 1q24-25 deletion syndrome | VUS-LP |
P36 | 10-yo/M | Trio | DD, behavioral issues, feeding difficulties, hyperextensible and buckling phalanges, dysmorphic facies | 26.3 kb loss at 14q32.3, mosaic (chr6:101261679-101288013)f {DN} | Kagami–Ogata syndrome (608149) | VUS |
P37 | 11-yo/F | Quad | ID, microcephaly, absent speech, ataxia, aggressive and self-injurious behavior, dysmorphic facies | 3.02 Mb loss at 2p25.3 (chr2:11314-3033976) 7.30 Mb gain at 16q23.3-24.3 (chr16:82865402-90163542) | Derivative chromosome 2 | P |
P38 | 1.5-yo/M | Quad with affected maternal half-brother | ID, ASD, prominent fetal pads, long fingers, multiple ear tags, bilateral ear pits, low hairline, microcephaly, non-verbal, non-ambulatory | 3.5 Mb gain at 22q11.1-q11.21 (chr22:16849364-20311389) 18.3 Mb gain at 11q23.3qter (chr11:116684536-134945187) | Emanuel syndrome (609029) | P |
Multiple variant types implicated in primary molecular diagnoses | ||||||
|---|---|---|---|---|---|---|
ID | Age/gender | Family structurea | Phenotype | Genomic variant(s) {molecular state-inheritance} | Associated condition (phenotype MIM number) | Classificationb |
P39 | 14-yo/F | Trio | DD including cognitive deficiency and lack of speech, growth deficiency, epilepsy, behavioral issues including autism and self-injurious tendencies, lack of secondary sexual characteristics, coarse facies, long tapered fingers, thick lips, over-folded ears, broad-based and duck-footed gait, lactose intolerance, constipation | SCN2A c.224C>G (p.Ser75Ter) {het-DN} [NM_001040142.1] KISS1R c.233A>G (p.Asn78Ser) {hem-mat} [NM_032551.4] 358.7 kb loss at 19p13.3 (chr19:916637-1275315) – Includes full-gene deletion of KISS1R and STK11 {DN} Incidental finding: CHEK2 c.349A>G (p.Arg117Gly) {het-mat} [NM_007194.3] | SCN2A-related disorders (607745); AD Isolated GnRH Deficiency (614837); AR Isolated GnRH Deficiency (614837); AR and Peutz–Jeghers syndrome (175200); AD as secondary finding CHEK2-related cancer susceptibility (609265); AD | P VUS P LP |
P40 | 1-yo/M | Trio | Joint contractures, short neck, dysmorphic facies, bilateral cryptorchidism, micrognathia, hypoplastic corpus callosum | ECEL1 c.793C>T (p.Gln265Ter) {het-pat} [NM_004826.2] ECEL1 c.110_155delTCCCGTTGGGC GCTGCGCGCAGCGCCACCGGGGCCCGGTCCGGGCT (p.Phe37CysfsTer151) {het-mat}g [NM_004826.2] | Distal arthrogryposis, type 5D (615065); AR | LP LP |
P41 | 9-yo/M | Trio with mother affected with myopathy | Scapular winging, severe muscle weakness, long and myopathic facies, clinical diagnosis of Down syndrome Mother: Muscle weakness and abnormal muscle biopsy | ACTA1 c.821C>T (p.Ala274Val) {het-mat} [NM_001100.3] Depth of 3× on chr 21 | Nemaline myopathy (161800); AD Trisomy 21/Down syndrome (190685)h | LP P |
