Extended Data Fig. 3: Quality control metrics for Spatial-DMT datasets.
From: Spatial joint profiling of DNA methylome and transcriptome in tissues
a, Barcode rank plots showing the distribution of reads per spatial barcode for E11, E13 embryos, and P21 brain samples. Valid barcodes are shown in blue, and filtered barcodes are shown in orange. b, Box plots, where the central line represents the median, the lower and upper hinges indicate the first and third quartiles, and the whiskers extend to the most extreme data points within 1.5 times the interquartile range (IQR) from the hinges, showing the duplication rate for E11, E13 embryos, and P21 brain samples, and other single-cell DNA methylation datasets12,67. The y-axis represents the percentage of duplicated reads (n = 278 cells for Cabernet Embryo, n = 927 cells for SciMETv2 LA Brain, n = 1619 cells for SciMETv2 SL Brain, n = 2,493 for E11 embryo (10 μm), n = 1,954 for E11 embryo 1 (50 μm), n = 1,947 for E11 embryo 2 (50 μm), n = 1,699 for E13 embryo (50 μm), and n = 2,235 for P21 brain (20 μm)). c, Box plots showing the mitochondrial retention rate for E11, E13 embryos, and P21 brain samples. The y-axis represents the percentage of reads mapped to the mitochondrial genome. d, Spatial distribution heatmaps of global DNA methylation levels in E11, E13 embryos (mCG), and P21 mouse brain (mCG and mCA). e, The conversion rate of unmethylated cytosine in the linker sequence in E11, E13 embryos, and P21 mouse brain. f, Percentage of reads with poly A (≥ 30 adenine), poly T (≥ 30 thymine), and TSO sequence (AAGCAGTGGTATCAACGCAGAGTACATGGG) in the DNA libraries of E11, E13 embryos, and P21 mouse brain.
