Figure 2

Biophysical evidence of RNA G4 formation at the 3′end of HCV negative strand. (A) Melting profiles from HCV110-131 5′CGGGAGGGGGGGUCCUGGAGGC3′ recorded at 295 nm in the presence of 10 mM lithium cacodylate buffer, pH 7.0 at 22 °C, containing either 100 mM of KCl, NaCl or LiCl. The HCV110-131 oligonucleotide concentration was 2.5 µM. (B) Thermal differential spectra recorded in the presence of 10 mM lithium cacodylate buffer, pH 7.0, containing either 100 mM of KCl, NaCl or LiCl. The HCV110-131 oligonucleotide concentration was 2.5 µM. (C) ¹H, 1D NMR spectrum recorded in 20 mM potassium phosphate buffer, pH 7, containing 70 mM KCl. The oligonucleotide concentration was 100 µM. D,E,F. FRET-melting assay recorded for f-HCV110-131-t RNA at 0.2 µM in 10 mM lithium cacodylate pH 7.2 containing 10 mM KCl and 10 mM LiCl. (D) FRET-melting in absence of ligand (white circles) or in the presence of 0.4 µM of ligand (blue circles, red square, blue square). For competition 3 µM and 10 µM of ds26 were added to the solution (red square and blue square). (E) FRET-melting in the absence of ligand (white circles) or in the presence of 0.4 µM of ligand (blue circles, red and blue squares). For competition 3 µM and 10 µM of HCV107-151 were added to the solution (red square and blue square). (F) Histogram representation of the stabilisation induced by PhenDC3 in absence of competitor (white) or in the presence of 3 µM (Cyan) or 10 µM (Blue) of competitor ds26 or HCV107-151.