Figure 5
Sequence alignment of the primer binding sites for the primers/probe for SHB sequences developed by Ward et al.48 compared with current known SHB haplotype variations. The primers and probe names for the real-time PCR assay from Ward et al.48 are listed in the top of the sequences. The reverse complement sequences for reverse primer SHB315R (TCCTGGTAGAATTAAAATATAAACTTCTGG) is listed as SHB315R(RC). All the SHB sequences were compared and the regions for the primers/probe were extracted and analysed. This figure only showed the unique sequences for this region and one of the accession number is listed. The numbers of the taxa with the identical sequences in the primers/probe binding region are listed in the bracket. The mismatches of the primers and probe with the SHB sequences are showed in bold letters. A concolor sequences were also listed for comparison.
