Figure 3
From: The yeast scavenger decapping enzyme DcpS and its application for in vitro RNA recapping
The effect of the secondary structure at the 5′ end of RNA on the decapping activity of yDcpS. Complementary synthetic RNA oligos were annealed to the 3′-FAM-labeled 25mer Cap 0 RNA to create a blunt (○), a 5′ extension (△), or a 5′ recession (□) as depicted on the right. The extent of decapping of each after 60 minutes at 37 °C with various concentrations of yDcpS was determined by capillary electrophoresis. The following complementary sequences were used for blunt, UUGAGCGUACUCGACGAAGUUCUAC; 5′ extension UUGAGCGUACUCGACGAAGU; and 5′ recession, UUGAGCGUACUCGACGAAGUUCUACAAUGACCAUC. The data points are an average of three replicates.
