Table 2 Set of primers designed for the alanine-tRNA ligase gene from Acanthamoeba spp.
From: Core gene-based molecular detection and identification of Acanthamoeba species
Primer name | Forward/Reverse | Sequence 5′-3′ | Length (nucleotides) | Amplicon size (bp) |
|---|---|---|---|---|
Lig1_F | Forward | CTTCAAGGAGGAGGCCAT | 18 | 684 bp |
Lig1_R | Reverse | CTGCTTGCCGTAKCGCAC | 18 | |
Lig2_F | Forward | GAGAACTTCTGGGAGATGGG | 20 | 783 bp |
Lig2_R | Reverse | CCTTCTCCTCGGCCATGAG | 19 | |
Lig3_F | Forward | CTCTGCGGTGGTACCCAC | 18 | 472 bp |
Lig3_R | Reverse | CGGATGGCCTTGATGGC | 17 |
