Table 2 Generated sequences in this study and their identification.
From: Potential zoonotic pathogens hosted by endangered bonobos
Agents | Used primers | Length and Tm | Obtained sequences | Amplified fragment | New sequence ID | Best blast hits (genebank acc number) |
|---|---|---|---|---|---|---|
EMCVs | P1-CCCTACCTCACGGAATGGGGCAAAG F1-TTATWATTAGGGCIGGYTTG F2-CTAGCAAAGACAGGRTAYAA R2-ACGRAAIGGGGCAAAGAG | Nested PCR: P1/F1 (400 bp) at 55 °C; then F2/R2 (250 bp) at 55 °C | 3 | 250 bp of 3D | MW046203–MW046205 | > 99% with ECMV Strain ATCC VR-129B (KM269482) |
Adenoviruses | Fw Outer-TGATGCGYTTCTTACCTYTGGTYTCCATGAG Rw Outer-AGTTYTACATGCTGGGCTCTTACCG Fw inner-GTGACAAAGAGGCTGTC-CGTGTCCCCGTA Rw inner- TCACGTGGCCTACACTTACA-AGCCAATCAC | Nested PCR: outer primers (≈ 1400 bp) at 58 °C, then Inner primers (≈ 250 bp) at 55 °C | 10 | 250 bp of DNA pol | – | 92 to 98% with SAdV-42.1 (FJ025903) and SAdV-42.2 (FJ025902) belonged to AdV-C |
1 | 93% with HAdV sp. isolate DT5 (MK241690) belonged to AdV-C | |||||
1 | SAdV-35 (FJ0259120) belonged to AdV-B | |||||
2 | SAdV-26 (FJ025923) and SAdV-39 (FJ025924) belonged to AdV-E | |||||
Leptospira spp. | F- TAGGAAATTGCGCAGCTACA R- GCATCGAGAGGAATTAACATCA | F/R (520 bp), 53 °C | 5 | 460–520 bp of LipL41 | MW067650–MW067654 | > 99% with L. interrogans serovar Grippotyphosa (JQ690557) |
Treponema spp. | F1-GGGAGTGAGACTGCGIGCG R2- GGTGTCASCMCCTATACGTCYCAT | F1/R2 (900 bp), 57 °C | 5 | 787–1039 bp of 23S | MT257118–MT257135 | > 99.5% with T. succinifaciens strain 609 (NR076867) and > 97.5% with Treponema spp. from other African NHPs |
3 | 95–98% with T. succinifaciens (NR076867) | |||||
1 | 93% with T. succinifaciens DSM 2489 (CP002631) | |||||
3 | 83% with T. succinifaciens DSM 2489 and T. brennaborense DSM 12,168 (CP002696) | |||||
7 | 78–88% with T. brennaborense and 81–99% with T. berlinense (FUXC01000026) | |||||
Oesophagostumum spp. | Fwd.18S.631-TCGTCATTGCTGCGGTTAAA Rwd.18S.1825r- GGTTCAAGCCACTGCGATTAA | 1127–1155 bp, 54 °C | 1 | 1100 bp of 18S | MT89 0583 | 99.5% and 99.4% with O. aculeatum (AB677956) and O. muntiacum NSMT:As4470 (LC415112) |
NC1-TTAGTTTCTTTTCCTCCGCT NC2-ACGTCTGGTTCAGGGTTGTT OesophITS2-21TGTRACACTGTTTGTCGAAC | Hemi-nested PCR: NC1/ NC2 (280–400 bp), 50 °C; NC2/ OesophITS2-21 (260 bp), 55 °C | 27 | 268–307 bp of ITS2 region | MW040123–MW040151 | > 99% with O. stephanostomum (KR149651) | |
2 | 97% with O. bifurcum (MT184890) and with O. cf. aculeatum (AB586134) | |||||
Kinetoplastida sp. | F720-GTTAAAGGGTTCGTAGTTGAA R1425- GACTACAATGGTCTCTAATCA | F720/R1425 (≈ 750 bp), 50 °C | 3 | 475–522 bp of 18S | MT886281–MT886283 | > 99% identity with Trypanosoma theleiri (KR024688) |
1 | MT886284 | > 99% Bodo saltans (MH614643) |
