Correction to: Scientific Reports https://doi.org/10.1038/s41598-020-77293-7, published online 26 November 2020
The original version of this Article contained a repeated error in the Results section, under the subheading ‘Gene expression analysis for ZEP paralogs by quantitative real-time PCR’, in Table 1, and in the Methods section, under the subheading ‘qRT-PCR assay for zeaxanthin epoxidase genes’, where
“g16894.t1”
now reads:
“g16874.t1”
In addition, the primer sequence of Actin was incorrect in the Methods section, under the subheading ‘qRT-PCR assay for zeaxanthin epoxidase genes’, where
“Actin (forward: GTTCATTCAAGCCCACAGAG; reverse: TCCTTCCTTCTTCATCAATCTTC)55 was used as a reference gene to normalise the gene expression of targets.”
now reads:
“Actin (forward: TGTTAGCAACTGGGATGATATGG; reverse: GGATAGCACAGCCTGAATAGC)55 was used as a reference gene to normalise the gene expression of targets.”
The original Article has been corrected.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Suematsu, K., Tanaka, M., Kurata, R. et al. Author Correction: Comparative transcriptome analysis implied a ZEP paralog was a key gene involved in carotenoid accumulation in yellow-fleshed sweetpotato. Sci Rep 11, 19019 (2021). https://doi.org/10.1038/s41598-021-98699-x
Published:
Version of record:
DOI: https://doi.org/10.1038/s41598-021-98699-x
