Correction to: Scientific Reports https://doi.org/10.1038/s41598-021-03016-1, published online 28 January 2022
The original version of this Article contained errors in the HPRT Reverse Primer and Probe primer sequences, which should read as: Antisense (HPRT-R) GGTCCTTTTCACCAGCAAGCT and Probe (HPRT-P) CTTTCCTTGGTCAGGCAGTATAATC. As a result, in the Materials and methods section, under the subheading ‘Semi-nested RTqPCR for sample enrichment’,
“The qPCRBIO 1-Step Go Lo-Rox Kit reagents (PCR Biosystems) and manufacturer recommended cycling parameters were used with 900 nM TGACACTGGCAAAACAATGCA HPRT Forward Primer, 900 nM AGCTTGCTGGTGAAAAGGACC HPRT Reverse Primer and 250 nM TTTCCTTGGTCAGGCAGTATAATC VIC/TAMRA Probe (ThermoFisher Scientific).”
now reads:
“The qPCRBIO 1-Step Go Lo-Rox Kit reagents (PCR Biosystems) and manufacturer recommended cycling parameters were used with 900 nM TGACACTGGCAAAACAATGCA HPRT Forward Primer, 900 nM GGTCCTTTTCACCAGCAAGCT HPRT Reverse Primer and 250 nM CTTCCTTGGTCAGGCAGTATAATC VIC/TAMRA Probe (ThermoFisher Scientific).”
Additionally, there was an error in 574P and 599R sequences in Table 2, where “I” should read “N”. Thermofisher does not provide the oigonucletides with an Inosine base. They provide equimolar amounts of each possible base in this position.
574P | LTR 574 ← 552 | Probe (total RNA or DNA) | 5′-FAM/ACAGAYGGGCACACACIACT/MGBNFQ-3′ |
599R | LTR 599 ← 582 | Reverse primer (total RNA or DNA) | 5′-AGGGATCTCTAGITACCA-3′ |
should read:
574P | LTR 574 ← 552 | Probe (total RNA or DNA) | 5′-FAM/ACAGAYGGGCACACACNACT/MGBNFQ-3′ |
599R | LTR 599 ← 582 | Reverse primer (total RNA or DNA) | 5′-AGGGATCTCTAGNTACCA-3′ |
The original Article has been corrected.
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Kibirige, C.N., Manak, M., King, D. et al. Author Correction: Development of a sensitive, quantitative assay with broad subtype specificity for detection of total HIV-1 nucleic acids in plasma and PBMC. Sci Rep 12, 11792 (2022). https://doi.org/10.1038/s41598-022-16308-x
Published:
Version of record:
DOI: https://doi.org/10.1038/s41598-022-16308-x