Table 2 Primer sequences, annealing temperatures, and amplicon length. GenBank accession No- AF440570.1.
From: A novel approach for DNA extraction of white spot syndrome virus detection in penaeid shrimp
Primers | Sequence details | GC% | annealing temp (°C) | Size (bp) |
|---|---|---|---|---|
VP28 F | 5’ ATGGATCTTTCTTTCACTCTTTC 3’ | 36.67% | 57 °C | 615 bp |
VP28 R | 5’ TTACTCGGTCTCAGTGCCAG 3’ | 56.67% | 57 °C | |
RVP28 F | 5′-AGGTGTGGAACAACACATCAAG-3 | 55.25% | 59 °C | 150 bp |
RVP28 R | 5′-TGCCAACTTCATCCTCATCA-3′ | 55.25% | 59 °C |
